Soil Project- English/Ramos

From MicrobeWiki, the student-edited microbiology resource
Jump to: navigation, search
This student page has not been curated.

Classification

Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus


Species

Fictibacillus sp


Genus species Classification Bacillus Arsenicus also known as Fictibacillus arsenicus

NCBI: Taxonomy

Microbiology

Habitat Information

Describe the location and conditions under which the organism was isolated.

Collection Date: September 7, 2017

Air Temp: 76%

Humidity: 36%

24Hr Rainfall: 0.00

Pressure: 30.03”

Solar Radiation: 22.53

Depth of collection: surface to 1 inch deep

Grid Coordinates: Lat 29.9425576 Long -98.4037259

Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.

Description and Significance

Colony Morphology

Margin: Smooth

Elevation: convex

Surface: smooth

Color: very light greenish tan

Soluble Pigment: opaque


Cellular morphology:

Gram positive rods in long chains.

Possible microbial activity: The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.

Significance

Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes. Arsenic resistant bacterium


Soil microorganism.png

Genome Structure

The soil microorganism was sent to a lab for sequencing and this was the result: AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC AACACCTAGNACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCACCCCACGCTTTCGCGCCTCAGC GTCAGTTACAGGCCAAAAAGCCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATT CCACTTTTCTCTCCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTT AGGAGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCNGATAACGCTTGCCACCTACGTATTACCGCGGCTGCTGGCAC GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA


Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result:

Select seq KM598247.1 Fictibacillus sp. THG-SQK1 16S ribosomal RNA gene, partial sequence


RID

2NMY0NWT015 (Expires on 12-10 01:02 am)

Query ID

lcl|Query_140973

Description

None

Molecule type

nucleic acid

Query Length 553

Database Name

nr

Description

Nucleotide collection (nt) Program

BLASTN 2.7.1+

Cell Structure, Metabolism and Life Cycle

From an internet research this is what we found on our soil microorganism:

Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.

The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile. After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.

Gram positive cell structure:

From results found in lab, organism was found to be gram positive. Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane.

Physiology and Pathogenesis

Enzyme produced: casein

Biochemical characteristics based on Chemical testing on the soil microorganism:

October 6th tests:

Phenol Red Broth: Negative for fermentation.

Starch Hydrolysis test: Negative.

Casein Hydrolysis Test: Positive.

Casein Hydrolisis.png

Gelatin Hydrolysis test: negative.

DNA hydrolysis: Negative.

Lipid hydrolysis: Negative.

October 20th:

Methyl Red and Voges-Proskauer: Negative.

Citrate test: Negative.

SIM medium test: Negative.

Nitrate reduction: Negative (first step and second step also negative).

Urea Hydrolysis test: Negative.

Triple Iron Sugar test: Negative for fermentation.

Oct. 27th tests:

Oxidase test: Negative.

MacConkey Agar test: Negative.

Eosin Methylene Blue agar test: Negative.

Hektoen Enteric Agar test: Negative.

Decarboxylation test: Negative.

Phenylalanine Deaminase Test: negative.

Nov 3rd:

Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.

Manitol salt agar: Negative.

Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.

Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.

Salt tolerance test: Negative.

Bile Esculin test: Negative.

Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.

Nov 10th

Antimicrobial susceptibility test (Kirby-Bauer method):

soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;  

Resistant to: Cefoxitin and Ceftazidime.

Disinfectants: highly sensitive to 100% Bleach. Somewhat sensitive to Lavender, 5% Bleach and Rosemary. Not sensitive to orange.Disinfectant susceptibility.png

Antimicrobial susceptibility.png

References

Genome sequence obtained from DNA BLAST web site https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch https://blast.ncbi.nlm.nih.gov/Blast.cgi


Pictures taken in class.

References

Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0

Author

Page authored by Tara English and Teresa Ramos, students of Prof. Kristine Hollingsworth at Austin Community College.