Difference between revisions of "JJDZ Soil"

From MicrobeWiki, the student-edited microbiology resource
Jump to: navigation, search
(Habitat Information)
(Species)
 
(56 intermediate revisions by the same user not shown)
Line 6: Line 6:
  
  
[[File:Ecoli_cell3.jpg|center|400px|caption]]
+
 
 +
 
 +
 
 +
 
 +
 
 +
[[File:Ecoli_cell3.jpg|center|400px|caption]][https://www.cdc.gov/ecoli/index.html]
  
  
Line 26: Line 31:
  
 
[[File:Ecoli cell.jpg|left|200px|caption]]
 
[[File:Ecoli cell.jpg|left|200px|caption]]
 
+
[http://ymbiodelaramdescherichiacoli.weebly.com/photo-gallery.html]
  
  
Line 40: Line 45:
 
*Escherichia coli
 
*Escherichia coli
 
*''NCBI Link:  Escherichia coli Taxonomy: [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562]''
 
*''NCBI Link:  Escherichia coli Taxonomy: [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562]''
 +
 
==Habitat Information ==  
 
==Habitat Information ==  
[[File:Copperfield park photo.png|left|500px|caption]]
+
 
 +
 
 +
[[File:Copperfield park.png|left|500px|caption]]
 +
 
 +
 
 +
 
 +
 
 +
 
  
  
Line 84: Line 97:
 
==Description and Significance==
 
==Description and Significance==
  
Antibiotic resistance in E. coli is of particular concern because it is the most common Gram-negative pathogen in humans, the most common cause of urinary tract infections, a common cause of both community and hospital-acquired bacteraemia as well as a cause of diarrhea. In addition, resistant E. coli strains have the ability to transfer antibiotic resistance not only to other strains of E.coli, but also to other bacteria within the gastrointestinal tract and to acquire resistance from other organisms. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4131821/]
 
  
 
*Colonial Appearance:   
 
*Colonial Appearance:   
Line 96: Line 108:
 
**Optical Property:  Translucent  
 
**Optical Property:  Translucent  
  
[[Describe the appearance (colonial and cellular), possible antimicrobial activity etc. of the organism, and why the organism might be significant.]]
+
*As gram-negative organisms, E. coli are resistant to many antibiotics. Antibiotics which may be used to treat E. coli infection include amoxicillin, penicillins, many cephalosporins, carbapenems, and the aminoglycosides.
 +
 
 +
*Antibiotic resistance in E. coli is of particular concern because it is the most common Gram-negative pathogen in humans, the most common cause of urinary tract infections, a common cause of both community and hospital-acquired bacteraemia as well as a cause of diarrhea. In addition, resistant E. coli strains have the ability to transfer antibiotic resistance not only to other strains of E.coli, but also to other bacteria within the gastrointestinal tract and to acquire resistance from other organisms. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4131821/]
  
 
==Genome Structure==
 
==Genome Structure==
Line 102: Line 116:
 
*E. coli has only one circular chromosome
 
*E. coli has only one circular chromosome
  
*GCACCTGTCTCACGGTTCCCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTT TTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCNNCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCG
+
*Nucleotide Genome Sequence: GCACCTGTCTCACGGTTCCCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTT TTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCNNCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCG
  
 
*Escherichia coli strain S17-13, complete genome
 
*Escherichia coli strain S17-13, complete genome
Line 117: Line 131:
 
              
 
              
 
''NCBI Link:  E. coli Strain S17-13: [https://www.ncbi.nlm.nih.gov/nucleotide/1285346620?report=genbank&log$=nuclalign&blast_rank=1&RID=2G0UP0E101R]''
 
''NCBI Link:  E. coli Strain S17-13: [https://www.ncbi.nlm.nih.gov/nucleotide/1285346620?report=genbank&log$=nuclalign&blast_rank=1&RID=2G0UP0E101R]''
 
[[Describe the size and content of the genome.  How many chromosomes?  Circular or linear?  Other interesting features?  What is known about its sequence? Include S Ribosomal sequence that you obtained from PCR and sequencing here.]]
 
  
 
==Cell Structure, Metabolism and Life Cycle==
 
==Cell Structure, Metabolism and Life Cycle==
Line 124: Line 136:
 
*Cell Structure:  E. Coli is a Gram-negative, facultatively anaerobic, rod-shaped, coliform bacterium. [https://en.wikipedia.org/wiki/Escherichia_coli].  It also possesses adhesive fimbriae and a cell wall that consists of an outer membrane containing lipopolysaccharides, a periplasmic space with a peptidoglycan layer, and an inner, cytoplasmic membrane. [https://microbewiki.kenyon.edu/index.php/Escherichia_coli].  The integument, the tough outer protective layer, protects the bacterium from other organisms or oppressors.  
 
*Cell Structure:  E. Coli is a Gram-negative, facultatively anaerobic, rod-shaped, coliform bacterium. [https://en.wikipedia.org/wiki/Escherichia_coli].  It also possesses adhesive fimbriae and a cell wall that consists of an outer membrane containing lipopolysaccharides, a periplasmic space with a peptidoglycan layer, and an inner, cytoplasmic membrane. [https://microbewiki.kenyon.edu/index.php/Escherichia_coli].  The integument, the tough outer protective layer, protects the bacterium from other organisms or oppressors.  
  
*Metabolism:  E.coli has fairly simple nutritional requirements.  It is a heterotrophic organism, therefor it cannot produce its own food and it must obtain nutrition and energy by taking it from other organisms, most often its host.  Carbon is very important to e-coli, and it obtains its carbon from glucose.
+
*Metabolism:  E.coli has fairly simple nutritional requirements.  It is a heterotrophic organism, therefor it cannot produce its own food and it must obtain nutrition and energy by taking it from other organisms, most often its host.  Carbon is very important to e-coli, and it obtains its carbon from glucose. Glucose is the preferred and most frequently available energy source for E. coli. The enzymes to metabolize glucose are made constantly by E. coli. [http://www.phschool.com/science/biology_place/biocoach/lacoperon/energy.html]
 
 
*Reproduction Cycle:  E-coli has a very rapid growth cycle; it reproduces by either cell (binary) division (asexual) or through conjugation (sex pilus), the most common reproductive method is asexual reproduction. The time required for a complete cycle varies depending on several factors, however in optimal nutrient conditions, E. Coli can duplicate in about 20 minutes.  
 
 
 
*Life Cycle: In terms of its life cycle, it has a lag phase (growth is slow), log phase (bacteria multiplies exponentially), stationary phase (bacteria growth stabilizes), and death phase.  
 
 
 
 
 
 
 
  
[[Interesting features of cell structure; how it gains energy; what important molecules it produces.]]
+
*Reproduction Cycle:  E-coli has a very rapid growth cycle; it reproduces by either cell (binary) division (asexual) or through conjugation (sex pilus), the most common reproductive method is asexual reproduction. The time required for a complete cycle varies depending on several factors, however in optimal nutrient conditions, E. Coli can duplicate in about 20 minutes.
  
 
==Physiology and Pathogenesis==
 
==Physiology and Pathogenesis==
  
 
Biochemical characteristics of E. coli:
 
Biochemical characteristics of E. coli:
 
 
 
{| class="wikitable"
 
{| class="wikitable"
 
|+ Characteristic Reactions
 
|+ Characteristic Reactions
 +
|- style="background:black; color:white;"
 +
|Tests
 +
|E-Coli
 +
|In class results of organism
 +
|-
 +
|MacConkey agar
 +
|LF positive, bright pink mucoid and bile precipitate
 +
|LF negative, no growth, no fermentation
 
|-
 
|-
 +
|- style="background:mediumaquamarine; color:black;"
 
|Lactose
 
|Lactose
 +
|Acid+, gas+
 
|Acid+, gas+
 
|Acid+, gas+
 
|-
 
|-
 
|Mannitol Fermentation
 
|Mannitol Fermentation
 
|positive, usually with gas
 
|positive, usually with gas
 +
|Negative
 
|-
 
|-
 
|Methyl-Red
 
|Methyl-Red
 
|Positive
 
|Positive
 +
|Negative
 
|-
 
|-
 
|Voges-Proskauer
 
|Voges-Proskauer
 
|Negative  
 
|Negative  
 +
|Positive
 
|-
 
|-
 +
|- style="background:mediumaquamarine; color:black;"
 +
|Catalase
 +
|Positive
 +
|Positive
 +
|-
 +
|- style="background:mediumaquamarine; color:black;"
 +
|Oxidase
 +
|Negative
 +
|Negative
 +
|-
 +
|- style="background:mediumaquamarine; color:black;"
 
|Citrate
 
|Citrate
 
|Negative
 
|Negative
 +
|Negative
 +
|-
 +
|Mannitol
 +
|Positive
 +
|Negative for fermentation - organism growth
 
|-
 
|-
 +
|- style="background:mediumaquamarine; color:black;"
 
|Urea
 
|Urea
 +
|No hydrolysis
 
|No hydrolysis  
 
|No hydrolysis  
 
|-
 
|-
 
|Gelatin Liquefaction
 
|Gelatin Liquefaction
 +
|Negative
 +
|Positive
 +
|-
 +
|Hemolysis (Alfa/Beta/Gamma)
 +
|Some Strains show Hemolysis
 +
|Beta Hemolysis
 +
|-
 +
|- style="background:mediumaquamarine; color:black;"
 +
|DNase
 +
|Negative
 +
|Positive
 +
|-
 +
|Mannitol
 +
|Positive
 +
|Negative Fermentation / Organism grew
 +
|-
 +
|- style="background:mediumaquamarine; color:black;"
 +
|Bacitracin
 +
|Negative
 +
|Negative
 +
|-
 +
|- style="background:mediumaquamarine; color:black;"
 +
|Optochin
 +
|Negative
 
|Negative
 
|Negative
 
|}
 
|}
  
 +
*Organism Significance:
 +
**E-Coli is typically harmless and lives in gut flora within mammal’s intestines. Most types of E. coli are harmless and even help keep your digestive tract healthy. It produces Vitamin K2 and It normally exists symbiotic relationships with pathogenic bacteria. E-coli is expelled into the environment through fecal matter. Some strains can cause serious food poisoning in humans if food or drinks get contaminated. An example is the Shiga toxin-producing E. coli (STEC), it can cause severe food-borne disease. [https://en.wikipedia.org/wiki/Shigatoxigenic_and_verotoxigenic_Escherichia_coli]. It is transmitted to humans primarily through consumption of contaminated foods, such as raw or under cooked ground meat products, raw milk, and contaminated raw vegetables and sprouts & ground beef. When cattle are slaughtered and processed, E. coli bacteria in their intestines can get on the meat, unpasteurized milk, fresh produce
 +
**E. coli comprises an extremely large population of bacteria that display a very high amount of genetic and phenotypic diversity. There has been extensive genome sequencing of a large number of E. coli strains, it is reasonable to say that it needs a new taxonomic classification.
 +
**Uropathogenic E. coli (UPEC) is responsible for approximately 90% of urinary tract infections.  [https://en.wikipedia.org/wiki/Pathogenic_Escherichia_coli#Virulence_properties]
  
[[Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any). If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms]]
+
*Contributing factors to environment:
 +
**The sustainability of land and water resources is under pressure due to growing demands on agricultural systems to deliver food for an increasing world population. One source of pressure can be attributed to livestock agriculture and the production of large volumes of feces and associated manures. If managed effectively, fecal contributions to agricultural land from livestock can serve as a valuable farm resource and organic fertilizer, but if mismanaged and combined with opportunities for hydro-logical transfer, they can threaten water quality draining from catchment systems with a range of pollutants.  
 +
 
 +
*Virulent factors: the more virulence factors a strain has, the more severe the infection can be.
 +
**They use an adhesin known as intimin to bind host intestinal cells
 +
**Bacterial frimbriae for attachment
 +
**Produce enterotoxins
 +
 
 +
*Symptoms and disease in human hosts: Symptoms will vary dependent on the strain. Symptoms can be mild and some can lead to organ failure and even death.
 +
**Common symptoms are diarrhea, fever
 +
**Serious symptoms are bloody diarrhea, kidney failure, meningitis in neonates
 +
 
 +
*Symptoms and disease in animal hosts: the more virulent strains are capable of many diseases especially in cows and poultry
 +
**Septicemia, Diarrhea, Mastitis (utter infection) in bovine
 +
**Respiratory disease common in poultry
  
 
==References==
 
==References==
  
<nowiki>https://www.ncbi.nlm.nih.gov</nowiki>
+
https://www.ncbi.nlm.nih.gov
  
<nowiki>https://microbewiki.kenyon.edu/index.php/Escherichia_coli</nowiki>
+
https://microbewiki.kenyon.edu/index.php/Escherichia_coli
  
<nowiki>http://bioweb.uwlax.edu/bio203/s2008/moder_just/nutrition.htm</nowiki>
+
http://bioweb.uwlax.edu/bio203/s2008/moder_just/nutrition.html
  
 
http://ymbiodelaramdescherichiacoli.weebly.com/photo-gallery.html
 
http://ymbiodelaramdescherichiacoli.weebly.com/photo-gallery.html
 +
 +
https://microbiologyinfo.com/biochemical-test-and-identification-of-e-coli
 +
 +
https://www.cdc.gov
 +
 +
http://www.phschool.com/science/biology_place/biocoach/lacoperon/energy.html
  
 
==Author==
 
==Author==

Latest revision as of 19:35, 8 December 2017

This student page has not been curated.
caption
[1]


Classification

  • Domain: Bacteria
  • Phylum: Proteobacteria
  • Class: Gammaproteobacteria
  • Order: Enterobacterales
  • Family: Enterobacteriaceae

Species

caption

[2]






  • Escherichia coli
  • NCBI Link: Escherichia coli Taxonomy: [3]

Habitat Information

caption















  • Soil Sample Location: Copperfield Park and Greenbelt - 1425 E Yager Ln, Austin, TX 78753
  • Soil Collection Date & time: 9/7/2017 @ 10:00 AM
  • Conditions Present at time of soil collection:
    • No recent rain within past 48 hours
    • Temperature was 71 degrees F
  • Soil sample was retrieved at a depth of roughly 3 inches and about 6-8 inches from creek bed.
  • Description of Area:
    • Pond and creek area
    • Moderate erosion
    • Wildlife present (actually saw a coyote when collecting sample)
    • Area was damp and wet (close to creek bed)
    • Area gets roughly 1/2 day of sunlight everyday

Description and Significance

  • Colonial Appearance:
    • Shape: Circular
    • Margin: Entire
    • Elevation: Raised
    • Size: Punctiform, small
    • Texture: Smooth
    • Appearance: Shiny
    • Pigmentation: Non-pigmented / colorless
    • Optical Property: Translucent
  • As gram-negative organisms, E. coli are resistant to many antibiotics. Antibiotics which may be used to treat E. coli infection include amoxicillin, penicillins, many cephalosporins, carbapenems, and the aminoglycosides.
  • Antibiotic resistance in E. coli is of particular concern because it is the most common Gram-negative pathogen in humans, the most common cause of urinary tract infections, a common cause of both community and hospital-acquired bacteraemia as well as a cause of diarrhea. In addition, resistant E. coli strains have the ability to transfer antibiotic resistance not only to other strains of E.coli, but also to other bacteria within the gastrointestinal tract and to acquire resistance from other organisms. [4]

Genome Structure

  • E. coli has only one circular chromosome
  • Nucleotide Genome Sequence: GCACCTGTCTCACGGTTCCCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTT TTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCNNCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCG
  • Escherichia coli strain S17-13, complete genome
           Genes (total)          :: 5,359
           CDS (total)            :: 5,234
           Genes (coding)         :: 4,987
           CDS (coding)           :: 4,987
           Genes (RNA)            :: 125
           rRNAs                  :: 8, 7, 7 (5S, 16S, 23S)
           complete rRNAs         :: 8, 7, 7 (5S, 16S, 23S)
           tRNAs                  :: 90
           ncRNAs                 :: 13
           

NCBI Link: E. coli Strain S17-13: [5]

Cell Structure, Metabolism and Life Cycle

  • Cell Structure: E. Coli is a Gram-negative, facultatively anaerobic, rod-shaped, coliform bacterium. [6]. It also possesses adhesive fimbriae and a cell wall that consists of an outer membrane containing lipopolysaccharides, a periplasmic space with a peptidoglycan layer, and an inner, cytoplasmic membrane. [7]. The integument, the tough outer protective layer, protects the bacterium from other organisms or oppressors.
  • Metabolism: E.coli has fairly simple nutritional requirements. It is a heterotrophic organism, therefor it cannot produce its own food and it must obtain nutrition and energy by taking it from other organisms, most often its host. Carbon is very important to e-coli, and it obtains its carbon from glucose. Glucose is the preferred and most frequently available energy source for E. coli. The enzymes to metabolize glucose are made constantly by E. coli. [8]
  • Reproduction Cycle: E-coli has a very rapid growth cycle; it reproduces by either cell (binary) division (asexual) or through conjugation (sex pilus), the most common reproductive method is asexual reproduction. The time required for a complete cycle varies depending on several factors, however in optimal nutrient conditions, E. Coli can duplicate in about 20 minutes.

Physiology and Pathogenesis

Biochemical characteristics of E. coli:

Characteristic Reactions
Tests E-Coli In class results of organism
MacConkey agar LF positive, bright pink mucoid and bile precipitate LF negative, no growth, no fermentation
Lactose Acid+, gas+ Acid+, gas+
Mannitol Fermentation positive, usually with gas Negative
Methyl-Red Positive Negative
Voges-Proskauer Negative Positive
Catalase Positive Positive
Oxidase Negative Negative
Citrate Negative Negative
Mannitol Positive Negative for fermentation - organism growth
Urea No hydrolysis No hydrolysis
Gelatin Liquefaction Negative Positive
Hemolysis (Alfa/Beta/Gamma) Some Strains show Hemolysis Beta Hemolysis
DNase Negative Positive
Mannitol Positive Negative Fermentation / Organism grew
Bacitracin Negative Negative
Optochin Negative Negative
  • Organism Significance:
    • E-Coli is typically harmless and lives in gut flora within mammal’s intestines. Most types of E. coli are harmless and even help keep your digestive tract healthy. It produces Vitamin K2 and It normally exists symbiotic relationships with pathogenic bacteria. E-coli is expelled into the environment through fecal matter. Some strains can cause serious food poisoning in humans if food or drinks get contaminated. An example is the Shiga toxin-producing E. coli (STEC), it can cause severe food-borne disease. [9]. It is transmitted to humans primarily through consumption of contaminated foods, such as raw or under cooked ground meat products, raw milk, and contaminated raw vegetables and sprouts & ground beef. When cattle are slaughtered and processed, E. coli bacteria in their intestines can get on the meat, unpasteurized milk, fresh produce
    • E. coli comprises an extremely large population of bacteria that display a very high amount of genetic and phenotypic diversity. There has been extensive genome sequencing of a large number of E. coli strains, it is reasonable to say that it needs a new taxonomic classification.
    • Uropathogenic E. coli (UPEC) is responsible for approximately 90% of urinary tract infections. [10]
  • Contributing factors to environment:
    • The sustainability of land and water resources is under pressure due to growing demands on agricultural systems to deliver food for an increasing world population. One source of pressure can be attributed to livestock agriculture and the production of large volumes of feces and associated manures. If managed effectively, fecal contributions to agricultural land from livestock can serve as a valuable farm resource and organic fertilizer, but if mismanaged and combined with opportunities for hydro-logical transfer, they can threaten water quality draining from catchment systems with a range of pollutants.
  • Virulent factors: the more virulence factors a strain has, the more severe the infection can be.
    • They use an adhesin known as intimin to bind host intestinal cells
    • Bacterial frimbriae for attachment
    • Produce enterotoxins
  • Symptoms and disease in human hosts: Symptoms will vary dependent on the strain. Symptoms can be mild and some can lead to organ failure and even death.
    • Common symptoms are diarrhea, fever
    • Serious symptoms are bloody diarrhea, kidney failure, meningitis in neonates
  • Symptoms and disease in animal hosts: the more virulent strains are capable of many diseases especially in cows and poultry
    • Septicemia, Diarrhea, Mastitis (utter infection) in bovine
    • Respiratory disease common in poultry

References

https://www.ncbi.nlm.nih.gov

https://microbewiki.kenyon.edu/index.php/Escherichia_coli

http://bioweb.uwlax.edu/bio203/s2008/moder_just/nutrition.html

http://ymbiodelaramdescherichiacoli.weebly.com/photo-gallery.html

https://microbiologyinfo.com/biochemical-test-and-identification-of-e-coli

https://www.cdc.gov

http://www.phschool.com/science/biology_place/biocoach/lacoperon/energy.html

Author

Page authored by Jennifer Jordan and Denise Zamarrippa, student of Prof. Kristine Hollingsworth at Austin Community College.