Megan.Goldman Research Project

From MicrobeWiki, the student-edited microbiology resource
Revision as of 21:34, 8 May 2015 by Megan.goldman (talk | contribs) (Physiology and Pathogenesis)
Jump to: navigation, search
This student page has not been curated.

Domain: Bacteria Kingdom: Bscterioldetes/chlorobi Phylum: Proteobacteria Class: Gammaproteobacteria Order: Enterobacteriales Family: Enterobacteriaceae Genus: Klebsiella Species: K. pneumoniae The subject Klebsiella pneumoniae was found in heavy clay soil, near the waterline of a lake in the middle of a golf course in Kyle, TX 78640 on January 29, 2015. The subject was located at 30.017163 - 97.880556

The subject is has a perfectly circular margin, convex and is shiny, moist and opaque looking.It is a gram-negative bacillus that is a facultative anaerobe. Klebsiella species are examples of Enterobacteriaceae and a normal part of the human gut bacteria. It is becoming increasingly antibiotic resistant.

Genome Structure

Klebsiella pneumoniae strain RSO20 16S ribosomal RNA gene, partial sequence. Description: Klebsiella pneumoniae strain RSO20 16S ribosomal RNA gene, partial sequence. Molecule type: Nucleic acid. There was no information on the specific strain that is reviewed here. ttctttaaggtaaggaggtgatccaaccgcaggttcccctacggttaccttgttacgact


Cell Structure, Metabolism and Life Cycle

This bacteria has a polysaccharide capsule with fimbriae. The unique cell structure prevents against many host defense mechanisms. It naturally occurs in the soil and about 30% of strains can fix nitrogen in anaerobic condition.


Physiology and Pathogenesis

K. pneumoniae is one of the top organisms causing infections in hospitalized patients. These organisms can cause serious bloodstream infections and other serious infections that can potentially lead to fatality. It must enter the respiratory system to cause pneumonia or the blood stream to cause infection. Because its cellular structure is resistant to body defenses the infection can become severe.

caption

References:

"American Society for MicrobiologyInfection and Immunity." Capsule and Fimbria Interaction in Klebsiella Pneumoniae. Web. 8 May 2015. <http://iai.asm.org/content/73/8/4626.full>.

"Klebsiella Pneumoniae." Colony Morphology and Microscopic Appearance under Microscope. Images of . Antibiotic Treatment of Klebsiella Infections and Basic Tests for Laboratory Identification. 2013. Web. 8 May 2015. <http://www.microbiologyinpictures.com/klebsiella pneumoniae.html>.

"Klebsiella Pneumoniae in Healthcare Settings." Centers for Disease Control and Prevention. Centers for Disease Control and Prevention, 27 Aug. 2012. Web. 8 May 2015. <http://www.cdc.gov/HAI/organisms/klebsiella/klebsiella.html>.

Wattam, A.R., D. Abraham, O. Dalay, T.L. Disz, T. Driscoll, J.L. Gabbard, J.J. Gillespie, R. Gough, D. Hix, R. Kenyon, D. Machi, C. Mao, E.K. Nordberg, R. Olson, R. Overbeek, G.D. Pusch, M. Shukla, J. Schulman, R.L. Stevens, D.E. Sullivan, V. Vonstein, A. Warren, R. Will, M.J.C. Wilson, H. Seung Yoo, C. Zhang, Y. Zhang, B.W. Sobral (2014). “PATRIC, the bacterial bioinformatics database and analysis resource.” Nucl Acids Res 42 (D1): D581-D591. doi:10.1093/nar/gkt1099. PMID: 24225323.

Author

Page authored by Megan Goldman, student of Prof. Kristine Hollingsworth at Austin Community College.