Genus S and J: Difference between revisions

From MicrobeWiki, the student-edited microbiology resource
Line 59: Line 59:
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>
<ul>


This organism is gram negative. This means it has an inner layer of peptidoglycan in its cell wall as well as an outer layer of lipoprotein and lipopolysaccharides. It is endospore positive meaning that it can form spores when the environment is unfavorable and wait until conditions change. This increasing pathogenicity because it is harder to destroy in the body without harming good cells.  
This organism is gram negative. This means it has an inner layer of peptidoglycan in its cell wall as well as an outer layer of lipoprotein and lipopolysaccharides. It is endospore positive meaning that it can form spores when the environment is unfavorable and wait until conditions change. This increasing pathogenicity because it is harder to destroy in the body without harming good cells.  
Line 65: Line 67:


P. aeruginosa causes 10-20% of nosocomial infections and is especially pathogenic to those immune-suppressed patients such as burn victims, organ transplants, cystic fibrosis patients, and those who have long stays in hospital settings. An infection can cause meningitis, endocarditis, pneumonia, septicemia and more. The administration of aminoglycosides and penicillins is common and prompt attention is vital.
P. aeruginosa causes 10-20% of nosocomial infections and is especially pathogenic to those immune-suppressed patients such as burn victims, organ transplants, cystic fibrosis patients, and those who have long stays in hospital settings. An infection can cause meningitis, endocarditis, pneumonia, septicemia and more. The administration of aminoglycosides and penicillins is common and prompt attention is vital.
</ul>


==References==
==References==

Revision as of 20:55, 21 November 2016

This student page has not been curated.

<img src="https://s-media-cache-ak0.pinimg.com/originals/1d/2d/e7/1d2de7ece0ff9afa4dbedbe197089cc7.jpg" alt="P. aeruginosa">

Classification

Domain: Bacteria; Phylum: Proteobacteria; Class: Gammaproteobacteria; Order: Pseudomonadales; Family: Pseudomonadaceae; Genus: Pseudomonas; Species: P. aeruginosa

Species

NCBI: Taxonomy

Pseudomonas aeruginosa


Taxonomy ID: 1454219 Inherited blast name: g-proteobacteria

Habitat Information

Describe the location and conditions under which the organism was isolated.

Genome Structure

Describe the size and content of the genome. How many chromosomes? Circular or linear? Other interesting features? What is known about its sequence? Include S Ribosomal sequence that you obtained from PCR and sequencing here.

This organism has one circular chromosome and divides by binary fission. We identified the organism using PCR and gene sequencing of its rRNA genes below.


M17 GGGNNNNNNNNNTNNGNNNNTGGNNNNNNNTTNNNNNGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGNTNNTANAAGCACTTTAAGTTGGGAGGAAGGGCATTAACCTAATACGTTAGTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCGATAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCTGGCCTTGACATGCTGAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGANCTCAGACACAGGNNNNNNNNNGGGNNNNNNNNNTNNGNNNNTGGNNNNNNNTTNNNNNGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGNTNNTANAAGCACTTTAAGTTGGGAGGAAGGGCATTAACCTAATACGTTAGTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCGATAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCTGGCCTTGACATGCTGAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGANCTCAGACACAGG

GCAGACCCAATCAACCCGCTAGAAGAAAGTAGGCGCCAAATACAGTTCTACAGACGTGGCGCGTGTGTGGAGGATCTCCTCTTAATGGAGGCTCTCGATGTCGAAAGAATGATCATAACTTTCCTCTTTGAGTGTGCGGACGAAACAACCAGAGTATGCTCTTTTTATTTCCTTGCTAGCAGCTTCGATAGTACGAGGAATGCATGCGTAATTCGTAGTGACTGAACGTATTGCGCGCGTAGAAGAACCAGCAGGTGGAATGAGACCCCTTTGCCCTCATCTTGACATCTGCATCTTGTTCTACTGAGCTAGAGTACGCTGGAGATTGATGCATTCCCTTGTGAAGCGATGATTTGCGTATATATAGAAGGAATCTTTTGTGTCTAGGCCGACTTCTTGAACTGATACTGACTTTGAGATGCGAGGGCGTGAAAATAAGTTTGAATAAGTTCCTTTGAAAGTCTTCAATTAACCCAATGCCGATTAGCTTTGGAAATATTAGAGATATCAGAGAAGCAGCTATGTAGAGATGTCTACAGCTTGAAAAGAACAACTTCACGATGATCTTTCACTTAATTAGACGCTCCCGTGCGCACGAGCTGTAGAATATGTTGAATTACTAGGAACCGCGAGGAGCATCACATGCCGTCGTCATATTGAGAGCTCCCTACAGATAAATAGATGCGTCCTCAAGATCACACACACATG


M18

ACCTGTGTCTGAGCTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTCAGCATGTCANGGCCAGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTATCGCGTTAGCTGCGCCACTAAGATCTCAAGGATCCCAACGGCTAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATCAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCGTACTCTAGCTCAGTAGTTTTGGATGCAGTTCCCAGGTTGAGCCCGGGGCTTTCACATCCAACTTGCTGAACCACCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGTGCTTATTCTGTTGGTAACGTCAAAACACTAACGTATTAGGTTAATGCCCTTCCTCCCAACTTAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCANGCTTTCGCCCATTGTCCNNNNNNNNNNNNNNNNNNNNNACCTGTGTCTGAGCTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTCAGCATGTCANGGCCAGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTATCGCGTTAGCTGCGCCACTAAGATCTCAAGGATCCCAACGGCTAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATCAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACCCTCTACCGTACTCTAGCTCAGTAGTTTTGGATGCAGTTCCCAGGTTGAGCCCGGGGCTTTCACATCCAACTTGCTGAACCACCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGTGCTTATTCTGTTGGTAACGTCAAAACACTAACGTATTAGGTTAATGCCCTTCCTCCCAACTTAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCANGCTTTCGCCCATTGTCC

AGCAAACGAAACGCACACACTTCTGCCTCTTATAAATAGGATGCAATTCTATCTCTGATGTGTGCTCAGCACCTCTTTAAGGGCTGTGATCCTCCAAATAACTCCAATTAATTCGTCTTGCGCATCGGTTGGTGCGACCTAATATCTTTACATAAAATTAGGAGCATCCCGCCTGTCCTCGTTGGTCGATGTATTAATCTTGTGATCTCAGCGTCTATGATCTCTTTAATCTTATGGTATCGTCTATGTCTTAAGCGCTGAGAATTACGGTTATATCTATTCTTGTGCGCTCTGAATTCTGCCTCTTTTCAGTGTCTCTATCTCACTAGCTGATCACTTCCGCTATTGAAGAACTTCCTAATATCTCCGCTTCACTCATCTGCGGTGAACCTCCTATTTCATTCTACTGTAGTCTACCTCAGAAGAACGGCCTGCTGTCCTTACCACAAGCTGTAAAAAACAATATAATCGTCGCTAAGGAATTTCTTCTAATTAAACACGTACAAGTAAAGATAATTATTAGCACATTCCGTATAACAGCGAATGATGCAACAATGAAATCGTAAGCTAATACTGTGGCCATCATCTCGGCACTCTCTTGTAAGATGATTACGTTCCTTCTAACTTAATGGTGCTCAACATTCTTAGGACATCCTCCTCACACGCGCCATATTTGTATAAGACGCACTCGAACAGTCTACT



Cell Structure, Metabolism and Life Cycle

Interesting features of cell structure; how it gains energy; what important molecules it produces.

This microorganism is bacillus (rod shaped) and its colonial morphology is small, entire, convex, mucoid, and an opaque/tan color.

Physiology and Pathogenesis

Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.

    This organism is gram negative. This means it has an inner layer of peptidoglycan in its cell wall as well as an outer layer of lipoprotein and lipopolysaccharides. It is endospore positive meaning that it can form spores when the environment is unfavorable and wait until conditions change. This increasing pathogenicity because it is harder to destroy in the body without harming good cells. P. aeruginosa produces the enzyme deaminase, which removes the amine group from the amino acid phenylalanine and releases it as ammonia, producing phenylpyruvic acid as a result. When 10% ferric chloride is added to this medium, the presence of phenylpyruvic acid causes the media to turn dark green, a positive test result for deaminase (see picture below). P. aeruginosa causes 10-20% of nosocomial infections and is especially pathogenic to those immune-suppressed patients such as burn victims, organ transplants, cystic fibrosis patients, and those who have long stays in hospital settings. An infection can cause meningitis, endocarditis, pneumonia, septicemia and more. The administration of aminoglycosides and penicillins is common and prompt attention is vital.

References

[Sample reference] Bodey GP, Bolivar R, Fainstein V, Jadeja L. "'Infections caused by Pseudomonas aeruginosa'". Reviews of Infectious Diseases. 1983. Volume 5. p. 279-313.

Author

Page authored by Stephanie N. and Jessica G., students of Prof. Kristine Hollingsworth at Austin Community College.