Soil Sample Pseudomonas aeruginosa

This student page has not been curated.

Classification

• Domain: Bacteria

• Phylum: Proteobacteria

• Class: Gamma Proteobacteria

• Order: Pseudomonadales

• Family: Pseudomonadaceae

• Genus: Pesudomonas

Species

NCBI: Taxonomy

Pseudomonas aeruginosa

Habitat Information

The location of the soil sample was collected behind an apartment complex inside of a ditch. Due to recent rain of approximately two days the soil was silty clay, with 1 to 3 percent slopes. The depth of digging was from the surface to 2 1/2".

Date of Collection: 1/29/2015

Location: 289 Spring Lane Dripping Springs, TX 78620

Air temperature: 60 degrees F

Humidity: 40%

24-hr Rainfall: 20%

Latitude/Longitude: 26.4384N 21.0792W

Solar Radiation: 15.63

Description and Significance

Pseudomonas aeruginosa is a gram negative opportunistic bacteria that can be found in soil, water, plants, animals, humans, hospitals and other places that contain moisture. Colony morphology is pale brown/metallic sheen color, flat, irregular, entire smooth appearance, sweet corn tortilla odor. The cellular shape of P. aeruginosa is gram negative bacilli rods, motile, obligate aerobes. P.aeruginosa is the very common cause of infections naturally resistant to a large range of antibiotics. Immunocompromised patients with cancer, HIV/AIDS, cystic fibrosis, hospitalized patients, and individuals in the burn unit at a hospital as well are at a bigger risk contracting this bacteria.

Genome Structure

P.aeruginosa has a genome size of 5.2 to 7 million base pairs(Mbp) with 65% Guanine and Cytosine content. It has a single and supercoiled circular chromosome in the cytoplasm and variable number of plasmids.

Pseudomonas aeruginosa strain DKBI 16S Ribosomal RNA gene partial sequence Max Score: 1310 Query cover: 100% Ident: 99% Accession: KM978038.1

AGCACCTGTGTCTGAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTCAGCATGTCAAGGCC AGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTT TAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTATCGCGTTAGCTGCGCCACTAAGATCTCAAGGATCCCAACGGCTA GTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTAT CAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACC CTCTACCGTACTCTAGCTCAGTAGTTTTGGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCCAACTTGCTGAACC ACCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAG CCGGTGCTTATTCTGTTGGTAACGTCAAAACAGCAAGGTATTAACTTACTGCCCTTCCTCCCAACTTAAAGTGCTTTACA ATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTGCTGCCACC

Cell Structure, Metabolism and Life Cycle

P.aeruginosa is a gram begative bacteria with a peptidoglycan layer an outer membrane that contains Protein F (OprF) that functions as prion which allows certain molecules and ions to come into the cells, and as a structural protein, it maintains the bacterial cell shape. Protein F provides the outer membrane with an exclusion limit which lowers permeability, which is a property that is desired because it decreases the intake of harmful substances into the cell, and causes resistance to antibiotics. This bacteria also uses single and polar flagellum to move around and display chemotaxis to useful molecules like sugar. It is a facultative aerobe which prefers respiration for metabolism. It gains energy by transferring electrons from glucose and reduced substrates to oxygen the final electron acceptor.

Physiology and Pathogenesis

Isolation of soil organism from an LB broth to a streak plate colony color brown/metallic sheen, sweet corn tortilla odor, entire flat smooth appearance.

• Citrate Test: Positive for carbon source

• Sulfur Indole Motility Test (SIM): positive for sulfur, negative no tryptophan is broken down into indole, positive for motility

• Triple Sugar Iron Agar (TSI): positive for glucose fermentation sulfur production/ acid production/gas

• MR/VP: MR negative, VP negative

• Nitrate Test: negative Nitrate to Nitrite, positive Nitrate to gas

• Urea Hydrolysis Test: positive rapid urea hydrolysis

• Decarboxilation Test (mineral oil added): Arginine= positive, Orthinine= light purple, Lysine= light purple

• Phenylalanine Test: negative

• Eosin Methylene Blue Agar: Positive good growth, dark probable coliform

• Hektoen Enteric Test: positive good growth, black ppt

• MacConkey Agar Test: positive good growth brick red color

• 6.5% Salt Tolerance Test: positive turbidity

• Bile Esculin Test: negative

• Phenylethyl Alcohol Agar Test: negative

• Mannitol Salt Agar Test: negative

• Blood Agar Test: beta clear zone complete breakdown

• Gram Stain: single pink rods

• Oxidase Test: negative results are questionable

Antimicrobials used Sulfisoxazole, Linezolid, Cefamandole, Ampicillin, the only antibiotic that appeared with light clear zone was Sulfixazole, Disinfectants used Lavender, Rosemary, Tea Tree, Oil of Oregano, the only disinfectant that appeared with clear zone was Tea Tree.

Pseudomonas aeruginosa uses virulence factor exotoxin A to inactivate eukaryotic elongation factor 2 through ADP-ribosylation in a host cell. Without elongations eukaryotic cells cannot synthesize proteins and necrotize. Intracellular contents induce immunological responses in immunocompromised patients that are hospitalized or have been hospitalized that have contracted the bacteria. P.aeruginosa is very well known in hospitals and is very resistant to antibiotics. Patients with cancer, HIV/AIDS, cystic fibrosis, patients with burn are at big risks in contracting this bacteria.

References

http://textbookofbacteriology.net/pseudomonas_2.html

https://microbewiki.kenyon.edu/index.php/Pseudomonas_aeruginosa#Cell_structure_and_metabolism

http://emedicine.medscape.com/article/226748-clinical

http://emedicine.medscape.com/article/226748-clinical

Author

Page authored by Priscilla Martinez, student of Prof. Kristine Hollingsworth at Austin Community College.