Soil Sample Pseudomonas aeruginosa

This student page has not been curated.

Classification

• Domain: Bacteria

• Phylum: Proteobacteria

• Class: Gamma Proteobacteria

• Order: Pseudomonadales

• Family: Pseudomonadaceae

• Genus: Pesudomonas

Species

NCBI: Taxonomy

Pseudomonas aeruginosa

Habitat Information

The location of the soil sample was collected behind an apartment complex inside of a ditch. Due to recent rain of approximately two days the soil was silty clay, with 1 to 3 percent slopes. The depth of digging was from the surface to 2 1/2".

Date of Collection: 1/29/2015

Location: 289 Spring Lane Dripping Springs, TX 78620

Air temperature: 60 degrees F

Humidity: 40%

24-hr Rainfall: 20%

Latitude/Longitude: 26.4384N 21.0792W

Solar Radiation: 15.63

Description and Significance

Pseudomonas aeruginosa is a gram negative opportunistic bacteria that can be found in soil, water, plants, animals, humans, hospitals and other places that contain moisture. Colony morphology is pale brown/metallic sheen color, flat, irregular, entire smooth appearance, sweet corn tortilla odor. The cellular shape of P. aeruginosa is gram negative bacilli rods, motile, obligate aerobes. P.aeruginosa is the very common cause of infections naturally resistant to a large range of antibiotics. Immunocompromised patients with cancer, HIV/AIDS, cystic fibrosis, hospitalized patients, and individuals in the burn unit at a hospital as well are at a bigger risk contracting this bacteria.

Genome Structure

P.aeruginosa has a genome size of 5.2 to 7 million base pairs(Mbp) with 65% Guanine and Cytosine content. It has a single and supercoiled circular chromosome in the cytoplasm and variable number of plasmids.

Sequence 1 MR 17 forward

Uncultured bacterium clone partial sequence BX14A A05 16 Sribosomal RNA gene Max Score: 747 Query Cover: 89% Identification: 97% Accession: JN213491.1

GATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGAT TGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGG CTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGT GGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAG GGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATATGAAGGAACACCACTGGCGAAGGCGACCACCTGGACTG ATACTGACACTGANGTGCGAAAGCGTGGGGAGCAAACATGATTATATACCGTGGAAGCCCGGGCCTTAAACTATGTCTTG TAGAACCTGCGATCCCTGATATATCNCCCGGGGCNTCTAAAACNAGANNNCTCCCNNCTGNGGAGANCNGNNNCGCGGGG AAAAA

Sequence 2 MR 18 reverse

Pseudomonas aeruginosa strain DKBI 16 Sribosomal

Cell Structure, Metabolism and Life Cycle

Interesting features of cell structure; how it gains energy; what important molecules it produces.

Physiology and Pathogenesis

Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.

References

[Sample reference] Takai, K., Sugai, A., Itoh, T., and Horikoshi, K. "Palaeococcus ferrophilus gen. nov., sp. nov., a barophilic, hyperthermophilic archaeon from a deep-sea hydrothermal vent chimney". International Journal of Systematic and Evolutionary Microbiology. 2000. Volume 50. p. 489-500.

Author

Page authored by Priscilla Martinez, student of Prof. Kristine Hollingsworth at Austin Community College.