Soil Sample Pseudomonas aeruginosa: Difference between revisions
Line 42: | Line 42: | ||
==Genome Structure== | ==Genome Structure== | ||
''P.aeruginosa has a genome size of 5.2 to 7 million base pairs(Mbp) with 65% Guanine and Cytosine content. It has a single and supercoiled circular chromosome in the cytoplasm and variable number of plasmids. | ''P.aeruginosa'' has a genome size of 5.2 to 7 million base pairs(Mbp) with 65% Guanine and Cytosine content. It has a single and supercoiled circular chromosome in the cytoplasm and variable number of plasmids. | ||
Sequence 1 MR 17 forward | |||
Uncultured bacterium clone partial sequence BX14A A05 16 Sribosomal RNA gene | |||
Uncultured bacterium clone partial sequence 16 | Max Score: 747 Query Cover: 89% Identification: 97% Accession: JN213491.1 | ||
GATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGAT | GATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGAT | ||
Line 58: | Line 57: | ||
TAGAACCTGCGATCCCTGATATATCNCCCGGGGCNTCTAAAACNAGANNNCTCCCNNCTGNGGAGANCNGNNNCGCGGGG | TAGAACCTGCGATCCCTGATATATCNCCCGGGGCNTCTAAAACNAGANNNCTCCCNNCTGNGGAGANCNGNNNCGCGGGG | ||
AAAAA | AAAAA | ||
Sequence 2 MR 18 reverse | |||
''Pseudomonas aeruginosa'' strain DKBI 16 Sribosomal | |||
==Cell Structure, Metabolism and Life Cycle== | ==Cell Structure, Metabolism and Life Cycle== |
Revision as of 06:08, 8 May 2015
Classification
- Domain: Bacteria
- Phylum: Proteobacteria
- Class: Gamma Proteobacteria
- Order: Pseudomonadales
- Family: Pseudomonadaceae
- Genus: Pesudomonas
Species
NCBI: Taxonomy |
Pseudomonas aeruginosa
Habitat Information
The location of the soil sample was collected behind an apartment complex inside of a ditch. Due to recent rain of approximately two days the soil was silty clay, with 1 to 3 percent slopes. The depth of digging was from the surface to 2 1/2".
Date of Collection: 1/29/2015
Location: 289 Spring Lane Dripping Springs, TX 78620
Air temperature: 60 degrees F
Humidity: 40%
24-hr Rainfall: 20%
Latitude/Longitude: 26.4384N 21.0792W
Solar Radiation: 15.63
Description and Significance
Pseudomonas aeruginosa is a gram negative opportunistic bacteria that can be found in soil, water, plants, animals, humans, hospitals and other places that contain moisture. Colony morphology is pale brown/metallic sheen color, flat, irregular, entire smooth appearance, sweet corn tortilla odor. The cellular shape of P. aeruginosa is gram negative bacilli rods, motile, obligate aerobes. P.aeruginosa is the very common cause of infections naturally resistant to a large range of antibiotics. Immunocompromised patients with cancer, HIV/AIDS, cystic fibrosis, hospitalized patients, and individuals in the burn unit at a hospital as well are at a bigger risk contracting this bacteria.
Genome Structure
P.aeruginosa has a genome size of 5.2 to 7 million base pairs(Mbp) with 65% Guanine and Cytosine content. It has a single and supercoiled circular chromosome in the cytoplasm and variable number of plasmids.
Sequence 1 MR 17 forward
Uncultured bacterium clone partial sequence BX14A A05 16 Sribosomal RNA gene Max Score: 747 Query Cover: 89% Identification: 97% Accession: JN213491.1
GATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGAT TGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGG CTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGT GGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAG GGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATATGAAGGAACACCACTGGCGAAGGCGACCACCTGGACTG ATACTGACACTGANGTGCGAAAGCGTGGGGAGCAAACATGATTATATACCGTGGAAGCCCGGGCCTTAAACTATGTCTTG TAGAACCTGCGATCCCTGATATATCNCCCGGGGCNTCTAAAACNAGANNNCTCCCNNCTGNGGAGANCNGNNNCGCGGGG AAAAA
Sequence 2 MR 18 reverse
Pseudomonas aeruginosa strain DKBI 16 Sribosomal
Cell Structure, Metabolism and Life Cycle
Interesting features of cell structure; how it gains energy; what important molecules it produces.
Physiology and Pathogenesis
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.
References
Author
Page authored by Priscilla Martinez, student of Prof. Kristine Hollingsworth at Austin Community College.