Micrococcus Yunnanesis: Difference between revisions

From MicrobeWiki, the student-edited microbiology resource
 
(50 intermediate revisions by the same user not shown)
Line 3: Line 3:
Micrococcus Yunnanesis classification supports the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus
Micrococcus Yunnanesis classification supports the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus


Domain
   
   
Kingdom: Bacteria
Kingdom: Bacteria
Line 9: Line 8:
Phylum:  Actinobacteria
Phylum:  Actinobacteria


Class;
Class:  Actinobacteria
   
   
Order:  Actinomycetales
Order:  Actinomycetales
   
   
family:  Micrococcacae  
Family:  Micrococcacae  
 
Genus:  Micrococcus


[Others may be used.  Use [http://www.ncbi.nlm.nih.gov/Taxonomy/ NCBI] link to find]
[Others may be used.  Use [http://www.ncbi.nlm.nih.gov/Taxonomy/ NCBI] link to find]
Line 32: Line 33:
Date of Collection: 9/08/2016
Date of Collection: 9/08/2016


Location: 18216 Weiss Lane Pflugerville, TX
Location: 18216 Weiss Lane Pflugerville, TX            


Air temperature: 84 degrees F
Air temperature: 84 degrees F
Line 38: Line 39:
Humidity: 70%
Humidity: 70%


24-hr Rainfall: 0.00 in
24-hr Rainfall: 0.00 in    
 
[[File:IndexGraphic226.jpg]]


==Description and Significance==
==Description and Significance==
Micrococcus Yunnanesis is a Gram positive and non spore forming bacteria that can be found isolated inside plant roots of Polyspora Axillaris. Colony morphology is yellowish, smooth appearance, and circular with entire margins. Strains of this microbe have been re-classified numerous times with previous names such as Microccoccus luteus and Sarcina subflava.
Micrococcus Yunnanesis is one of six species of genus Micrococcus. Strains of this microbe have been re-classified numerous times with previous names such as Microccoccus luteus and Sarcina subflava. It's a Gram-positive cocci that can be found isolated from plant roots of Polyspora Axillaris.
[[File:440px-Micrococcus_colonies_on_TSA.jpg|Colony Morphology]]
 
[[File:220px-GordoniaLasianthus21Jun03.jpg]]
 
It's colony morphology is beige, smooth appearance, and circular with entire margins. Disinfectant sensitivity with small inhibition by cloves and lysol. No antimicrobial sensitivity detected.
 
[[File:265px-M221.jpg|Colony Morphology]]
 
Cellular morphology is in tetrads, irregular clusters, and pairs [[File:Micrococcus_2.jpg]]


==Genome Structure==
==Genome Structure==
Describe the size and content of the genome.  How many chromosomes?  Circular or linear?  Other interesting features?  What is known about its sequence? Include S Ribosomal sequence that you obtained from PCR and sequencing here.


Our Genome came out to:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNGCNCGACGCCGCNNGNGTTGACGGCCNCCNNTATTGTAAACCTCTTTCNTAGGGAAGAAGCTAAATTGACGGTACCTGCNNAATAAGCACCGGCTAACTACGTGCCAACAGCCGCGGTAATACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGC
CTAAAGAGCTTNNATGCGGTTTGTCGCGTCTGTCGTGAAANNCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCACACTANACTGCAGTANGGAAGACTGGAATTCCTGGTGTAGCGCTGGAATGCCCACATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCTGTAACTGACGCTGAGGAGC
GAAAGCATGGGGAGCGAACAGGATTATATACCCTGGTAGTCCATGCCGAAAACGTTGGGCACTAGGTGTGGGGACCATTCCACGGTTTCCGCGCCGCACCTAACGCATTAAGTGCCCCGCCTGGGCAGTACNGCCGCAAGGCTACAACTCAAAGGAATTGACGGGNGCCCGCACAAGCGGCGGAGCATGCGGATT
AATTCGATGCANCGCGAANAACCTTACCAAGGCTTGANNTGTTCTCNATCGCCGTANANATACCGTTTNCCCTTTNNNGCGGGNTCNCNNNTGGTGCATGGTTGTCGNCAGCTCGTGTCNTGATATCTNNTAGCTGTTTNCTNGNNNNNNTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNN
GCNCGACGCCGCNNGNGTTGACGGCCNCCNNTATTGTAAACCTCTTTCNTAGGGAAGAAGCTAAATTGACGGTACCTGCNNAATAAGCACCGGCTAACTACGTGCCAACAGCCGCGGTAATACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCCTAAAGAGCTTNNATGCGGTTTGTCGCGTCTGTCGTGAA
NNCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCACATANACTGCAGTANGGAAGACTGGAATTCCTGGTGTAGCGCTGGAATGCCCACATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCTGTAACTGACGCTGAGGAGCGAAAGCATGGGGAGCGAACAGGATTATATACCCTGGTAGTC
CATGCCGAAAACGTTGGGCACTAGGTGTGGGGACCATTCCACGGTTTCCGCGCCGCACCTAACGCATTAAGTGCCCCGCCTGGGCAGTACNGCCGCAAGGCTACAACTCAAAGGAATTGACGGGNGCCCGCACAAGCGGCGGAGCATGCGGATTAATTCGATGCANCGCGAANAACCTTACCAAGGCTTGANNTG
TTCTCNATCGCCGTANANATACCGTTTNCCCTTTNNNGCGGGNTCNCNNNTGGTGCATGGTTGTCGNCAGCTCGTGTCNTGATATCTNNTAGCTGTTTNCTNGNNNNNNTNNAN. Not pretty or accurate.
M. Yunnanensis resembles other microccoci to a degree of 65.4 % in it's DNA structure. A sequencing of 16S rRNA gene was performed and it matched with M. Luteus at a 99.71% ratio. The ratios matched almost identically to other microccoci. The only notable exception to its structure was within its major fatty acids with iso-C 16 : 0 (14.25 %) a large number compared to the rest of the recognized Micrococcus species. With hybridazation experimentation and clear physiological differences indicate that the novel strain represents a separate genomic species. At this time, further testing is needed to indicate M. Yunannenensis' importance outside the realm of other Micrococci.


==Cell Structure, Metabolism and Life Cycle==
==Cell Structure, Metabolism and Life Cycle==
Interesting features of cell structure; how it gains energy; what important molecules it produces.


Cells are Gram-positive, aerobic, non-endospore-forming cocci (0.8–1 μm in diameter). Motility is not observed. Colonies on TSA are beige, smooth and circular with entire margins. No pigment is produced.
Temperature, pH and NaCl tolerance ranges for growth are 4–45 °C, pH 6–8 and 0–15 % (w/v), respectively. Optimal growth occurs at 28 °C and about pH 7.0–8.0. Catalase-positive and oxidase-negative.
Gelatin and starch are not hydrolysed. Negative for Methyl red, Voges–Proskauer reaction, urease and the reduction of nitrate.


==Physiology and Pathogenesis==
==Physiology and Pathogenesis==
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
 
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>
 
The cells are endophytic bacteria;  defined as  bacteria that colonizes the internal tissue of the plant while showing no external sign of infection or negative effect on their host. Considering the number of plants in the world, each having distinct types of entophytic bacteria, this can be suggested as common.
Micrococcus generally an endopythic bacteria can be an opportunistic pathogen, particularly in hosts with compromised immune systems, such as HIV patients. It can be difficult to identify Micrococcus as the cause of an infection, since the organism is a normally present in skin microflora, and the genus is seldom linked to disease. In rare cases, death of immunocompromised patients has occurred from pulmonary infections caused by Micrococcus. However, no human or animal testing has been done or documented on M. Yunannensis.
 
Microccoci can be catabolically versatile, with the ability to utilize a wide range of unusual substrates, such as pyridine, herbicides, chlorinated biphenyls, and oil. They can also be used to detox or biodegrade environmental pollutants.
 
Notably, Yunnanensis produces a “restriction enzyme” used for cutting DNA in biotechnology applications.


==References==
==References==
[Sample reference] [http://ijs.sgmjournals.org/cgi/reprint/50/2/489 Takai, K., Sugai, A., Itoh, T., and Horikoshi, K. "''Palaeococcus ferrophilus'' gen. nov., sp. nov., a barophilic, hyperthermophilic archaeon from a deep-sea hydrothermal vent chimney". ''International Journal of Systematic and Evolutionary Microbiology''. 2000. Volume 50. p. 489-500.]


Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots. "International Journal of systemic and Evolutionary Microbiology. 2009. Volume 59 p. 2383-2387
Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots. "International Journal of systemic and Evolutionary Microbiology. 2009. Volume 59 p. 2383-2387
Zhuang W, Tay J, Maszenan A, Krumholz L, Tay S (2003). "Importance of Gram-positive naphthalene-degrading bacteria in oil-contaminated tropical marine sediments". Lett Appl Microbiol. 36 (4): 251–7.
Doddamani H, Ninnekar H (2001). "Biodegradation of carbaryl by a Micrococcus species". Curr Microbiol. 43 (1): 69–73.
https://commons.m.wikimedia.org/wiki/File:Polyspora_axillaris_3698.JPG
https://commons.m.wikimedia.org/wiki/File:M221.jpg#mw-jump-to-license


==Author==
==Author==
Page authored by _____, student of Prof. Kristine Hollingsworth at Austin Community College.
Page authored by Thomas Dominguez and Orelia Daniels


<!-- Do not remove this line-->[[Category:Pages edited by students of Kristine Hollingsworth at Austin Community College]]
<!-- Do not remove this line-->[[Category:Pages edited by students of Kristine Hollingsworth at Austin Community College]]

Latest revision as of 20:37, 9 December 2016

This student page has not been curated.

Classification

Micrococcus Yunnanesis classification supports the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus


Kingdom: Bacteria

Phylum: Actinobacteria

Class: Actinobacteria

Order: Actinomycetales

Family: Micrococcacae

Genus: Micrococcus

[Others may be used. Use NCBI link to find]

Species

NCBI: Taxonomy

Genus species Micrococcus Yunnanensis

Habitat Information

The location of soil sample was collected at Pflugerville lake next to the hike and bike trail. Due to lack of rain the soil was very dry.

Date of Collection: 9/08/2016

Location: 18216 Weiss Lane Pflugerville, TX

Air temperature: 84 degrees F

Humidity: 70%

24-hr Rainfall: 0.00 in

IndexGraphic226.jpg

Description and Significance

Micrococcus Yunnanesis is one of six species of genus Micrococcus. Strains of this microbe have been re-classified numerous times with previous names such as Microccoccus luteus and Sarcina subflava. It's a Gram-positive cocci that can be found isolated from plant roots of Polyspora Axillaris.

220px-GordoniaLasianthus21Jun03.jpg

It's colony morphology is beige, smooth appearance, and circular with entire margins. Disinfectant sensitivity with small inhibition by cloves and lysol. No antimicrobial sensitivity detected.

Colony Morphology

Cellular morphology is in tetrads, irregular clusters, and pairs Micrococcus 2.jpg

Genome Structure

Our Genome came out to: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNGCNCGACGCCGCNNGNGTTGACGGCCNCCNNTATTGTAAACCTCTTTCNTAGGGAAGAAGCTAAATTGACGGTACCTGCNNAATAAGCACCGGCTAACTACGTGCCAACAGCCGCGGTAATACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGC CTAAAGAGCTTNNATGCGGTTTGTCGCGTCTGTCGTGAAANNCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCACACTANACTGCAGTANGGAAGACTGGAATTCCTGGTGTAGCGCTGGAATGCCCACATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCTGTAACTGACGCTGAGGAGC GAAAGCATGGGGAGCGAACAGGATTATATACCCTGGTAGTCCATGCCGAAAACGTTGGGCACTAGGTGTGGGGACCATTCCACGGTTTCCGCGCCGCACCTAACGCATTAAGTGCCCCGCCTGGGCAGTACNGCCGCAAGGCTACAACTCAAAGGAATTGACGGGNGCCCGCACAAGCGGCGGAGCATGCGGATT AATTCGATGCANCGCGAANAACCTTACCAAGGCTTGANNTGTTCTCNATCGCCGTANANATACCGTTTNCCCTTTNNNGCGGGNTCNCNNNTGGTGCATGGTTGTCGNCAGCTCGTGTCNTGATATCTNNTAGCTGTTTNCTNGNNNNNNTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNN GCNCGACGCCGCNNGNGTTGACGGCCNCCNNTATTGTAAACCTCTTTCNTAGGGAAGAAGCTAAATTGACGGTACCTGCNNAATAAGCACCGGCTAACTACGTGCCAACAGCCGCGGTAATACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCCTAAAGAGCTTNNATGCGGTTTGTCGCGTCTGTCGTGAA NNCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCACATANACTGCAGTANGGAAGACTGGAATTCCTGGTGTAGCGCTGGAATGCCCACATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCTGTAACTGACGCTGAGGAGCGAAAGCATGGGGAGCGAACAGGATTATATACCCTGGTAGTC CATGCCGAAAACGTTGGGCACTAGGTGTGGGGACCATTCCACGGTTTCCGCGCCGCACCTAACGCATTAAGTGCCCCGCCTGGGCAGTACNGCCGCAAGGCTACAACTCAAAGGAATTGACGGGNGCCCGCACAAGCGGCGGAGCATGCGGATTAATTCGATGCANCGCGAANAACCTTACCAAGGCTTGANNTG TTCTCNATCGCCGTANANATACCGTTTNCCCTTTNNNGCGGGNTCNCNNNTGGTGCATGGTTGTCGNCAGCTCGTGTCNTGATATCTNNTAGCTGTTTNCTNGNNNNNNTNNAN. Not pretty or accurate.

M. Yunnanensis resembles other microccoci to a degree of 65.4 % in it's DNA structure. A sequencing of 16S rRNA gene was performed and it matched with M. Luteus at a 99.71% ratio. The ratios matched almost identically to other microccoci. The only notable exception to its structure was within its major fatty acids with iso-C 16 : 0 (14.25 %) a large number compared to the rest of the recognized Micrococcus species. With hybridazation experimentation and clear physiological differences indicate that the novel strain represents a separate genomic species. At this time, further testing is needed to indicate M. Yunannenensis' importance outside the realm of other Micrococci.

Cell Structure, Metabolism and Life Cycle

Cells are Gram-positive, aerobic, non-endospore-forming cocci (0.8–1 μm in diameter). Motility is not observed. Colonies on TSA are beige, smooth and circular with entire margins. No pigment is produced. Temperature, pH and NaCl tolerance ranges for growth are 4–45 °C, pH 6–8 and 0–15 % (w/v), respectively. Optimal growth occurs at 28 °C and about pH 7.0–8.0. Catalase-positive and oxidase-negative. Gelatin and starch are not hydrolysed. Negative for Methyl red, Voges–Proskauer reaction, urease and the reduction of nitrate.

Physiology and Pathogenesis

The cells are endophytic bacteria; defined as bacteria that colonizes the internal tissue of the plant while showing no external sign of infection or negative effect on their host. Considering the number of plants in the world, each having distinct types of entophytic bacteria, this can be suggested as common. Micrococcus generally an endopythic bacteria can be an opportunistic pathogen, particularly in hosts with compromised immune systems, such as HIV patients. It can be difficult to identify Micrococcus as the cause of an infection, since the organism is a normally present in skin microflora, and the genus is seldom linked to disease. In rare cases, death of immunocompromised patients has occurred from pulmonary infections caused by Micrococcus. However, no human or animal testing has been done or documented on M. Yunannensis.

Microccoci can be catabolically versatile, with the ability to utilize a wide range of unusual substrates, such as pyridine, herbicides, chlorinated biphenyls, and oil. They can also be used to detox or biodegrade environmental pollutants.

Notably, Yunnanensis produces a “restriction enzyme” used for cutting DNA in biotechnology applications.

References

Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots. "International Journal of systemic and Evolutionary Microbiology. 2009. Volume 59 p. 2383-2387

Zhuang W, Tay J, Maszenan A, Krumholz L, Tay S (2003). "Importance of Gram-positive naphthalene-degrading bacteria in oil-contaminated tropical marine sediments". Lett Appl Microbiol. 36 (4): 251–7.

Doddamani H, Ninnekar H (2001). "Biodegradation of carbaryl by a Micrococcus species". Curr Microbiol. 43 (1): 69–73.

https://commons.m.wikimedia.org/wiki/File:Polyspora_axillaris_3698.JPG

https://commons.m.wikimedia.org/wiki/File:M221.jpg#mw-jump-to-license

Author

Page authored by Thomas Dominguez and Orelia Daniels