Micrococcus Yunnanesis: Difference between revisions

From MicrobeWiki, the student-edited microbiology resource
Line 69: Line 69:
The cells are endophytic bacteria  defined as  bacteria that colonizes the internal tissue of the plant while showing no external sign of infection or negative effect on their host. Considering the number of plants in the world, each having distinct types of entophytic bacteria, this can be suggested as common.
The cells are endophytic bacteria  defined as  bacteria that colonizes the internal tissue of the plant while showing no external sign of infection or negative effect on their host. Considering the number of plants in the world, each having distinct types of entophytic bacteria, this can be suggested as common.
Micrococcus generally an endopythic bacteria can be an opportunistic pathogen, particularly in hosts with compromised immune systems, such as HIV patients. It can be difficult to identify Micrococcus as the cause of an infection, since the organism is a normally present in skin microflora, and the genus is seldom linked to disease. In rare cases, death of immunocompromised patients has occurred from pulmonary infections caused by Micrococcus. However, no human or animal testing has been done or documented on M. Yunannensis.
Micrococcus generally an endopythic bacteria can be an opportunistic pathogen, particularly in hosts with compromised immune systems, such as HIV patients. It can be difficult to identify Micrococcus as the cause of an infection, since the organism is a normally present in skin microflora, and the genus is seldom linked to disease. In rare cases, death of immunocompromised patients has occurred from pulmonary infections caused by Micrococcus. However, no human or animal testing has been done or documented on M. Yunannensis.
Microccoci can be catabolically versatile, with the ability to utilize a wide range of unusual substrates, such as pyridine, herbicides, chlorinated biphenyls, and oil. They can also be used to detox or biodegrade environmental pollutants.


==References==
==References==

Revision as of 05:27, 4 December 2016

This student page has not been curated.

Classification

Micrococcus Yunnanesis classification supports the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus


Kingdom: Bacteria

Phylum: Actinobacteria

Class: Actinobacteria

Order: Actinomycetales

family: Micrococcacae

[Others may be used. Use NCBI link to find]

Species

NCBI: Taxonomy

Genus species Micrococcus Yunnanensis

Habitat Information

The location of soil sample was collected at Pflugerville lake next to the hike and bike trail. Due to lack of rain the soil was very dry.

Date of Collection: 9/08/2016

Location: 18216 Weiss Lane Pflugerville, TX

Air temperature: 84 degrees F

Humidity: 70%

24-hr Rainfall: 0.00 in

Description and Significance

Micrococcus Yunnanesis is a Gram-positive bacterium that can be found isolated inside plant roots of Polyspora Axillaris. It has cells that are Colony morphology is yellowish, smooth appearance, and circular with entire margins. Strains of this microbe have been re-classified numerous times with previous names such as Microccoccus luteus and Sarcina subflava.

Colony Morphology

Genome Structure

Describe the size and content of the genome. How many chromosomes? Circular or linear? Other interesting features? What is known about its sequence? Include S Ribosomal sequence that you obtained from PCR and sequencing here.

Our Genome came out to NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNGCNCGACGCCGCNNGNGTTGACGGCCNCCNNTATTGTAAACCTCTTTCNTAGGGAAGAAGCTAAATTGACGGTACCTGCNNAATAAGCACCGGCTAACTACGTGCCAACAGCCGCGGTAATACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCCTAAAGAGCTTNNATGCGGTTTGTCGCGTCTGTCG TGAAANNCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCACACTANACTGCAGTANGGAAGACTGGAATTCCTGGTGTAGCGCTGGAATGCCCACATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCTGTAACTGACGCTGAGGAGCGAAAGCATGGGGAGCGAACAGGATTATATACCCTGGTAGTCCATGCCGAAAACGTTGGGCACTAGGTGTG GGGACCATTCCACGGTTTCCGCGCCGCACCTAACGCATTAAGTGCCCCGCCTGGGCAGTACNGCCGCAAGGCTACAACTCAAAGGAATTGACGGGNGCCCGCACAAGCGGCGGAGCATGCGGATTAATTCGATGCANCGCGAANAACCTTACCAAGGCTTGANNTGTTCTCNATCGCCGTANANATACCGTTTNCCCTTTNNNGCGGGNTCNCNNNTGGTGCATGGTTGT CGNCAGCTCGTGTCNTGATATCTNNTAGCTGTTTNCTNGNNNNNNTNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNGCNCGACGCCGCNNGNGTTGACGGCCNCCNNTATTGTAAACCTCTTTCNTAGGGAAGAAGCTAAATTGACGGTACCTGCNNAATAAGCACCGGCTAACTACGTGCCAACAGCCGCGGTAATACGTAGGGTGCGAGCGTTA TCCGGAATTATTGGGCCTAAAGAGCTTNNATGCGGTTTGTCGCGTCTGTCGTGAAANNCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCACACTANACTGCAGTANGGAAGACTGGAATTCCTGGTGTAGCGCTGGAATGCCCACATATCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCTGTAACTGACGCTGAGGAGCGAAAGCATGGGGAGCGAAC AGGATTATATACCCTGGTAGTCCATGCCGAAAACGTTGGGCACTAGGTGTGGGGACCATTCCACGGTTTCCGCGCCGCACCTAACGCATTAAGTGCCCCGCCTGGGCAGTACNGCCGCAAGGCTACAACTCAAAGGAATTGACGGGNGCCCGCACAAGCGGCGGAGCATGCGGATTAATTCGATGCANCGCGAANAACCTTACCAAGGCTTGANNTGTTCTCNATCGCCG TANANATACCGTTTNCCCTTTNNNGCGGGNTCNCNNNTGGTGCATGGTTGTCGNCAGCTCGTGTCNTGATATCTNNTAGCTGTTTNCTNGNNNNNNTNNAN. Not pretty or accurate.

The 16S rRNA gene sequencing was performed and it matched with M. Letus at a 99.71% ratio. The ratios matched almost identically to other microccoci. The only notable exception to its structure was within its major fatty acids with iso-C 16 : 0 (14.25 %) a large number compared to the rest of the recognized Micrococcus species. With hybridazation experimentation and clear physiological differences indicate that the novel strain represents a separate genomic species. At this time, further testing is needed to indicate M. Yunannenensis' importance outside the realm of other Micrococci.

Cell Structure, Metabolism and Life Cycle

Cells are Gram-positive, aerobic, non-endospore-forming cocci (0.8–1 μm in diameter). Motility is not observed. Colonies on TSA are yellow, smooth and circular with entire margins. No pigment is produced. Temperature, pH and NaCl tolerance ranges for growth are 4–45 °C, pH 6–8 and 0–15 % (w/v), respectively. Optimal growth occurs at 28 °C and about pH 7.0–8.0. Catalase-positive and oxidase-negative. Gelatin and starch are not hydrolysed. Negative for Methyl red, Voges–Proskauer reaction, urease and the reduction of nitrate.

Physiology and Pathogenesis

Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.

The cells are endophytic bacteria defined as bacteria that colonizes the internal tissue of the plant while showing no external sign of infection or negative effect on their host. Considering the number of plants in the world, each having distinct types of entophytic bacteria, this can be suggested as common. Micrococcus generally an endopythic bacteria can be an opportunistic pathogen, particularly in hosts with compromised immune systems, such as HIV patients. It can be difficult to identify Micrococcus as the cause of an infection, since the organism is a normally present in skin microflora, and the genus is seldom linked to disease. In rare cases, death of immunocompromised patients has occurred from pulmonary infections caused by Micrococcus. However, no human or animal testing has been done or documented on M. Yunannensis.

Microccoci can be catabolically versatile, with the ability to utilize a wide range of unusual substrates, such as pyridine, herbicides, chlorinated biphenyls, and oil. They can also be used to detox or biodegrade environmental pollutants.

References

Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots. "International Journal of systemic and Evolutionary Microbiology. 2009. Volume 59 p. 2383-2387

Author

Page authored by Thomas Dominguez and Orelia Daniels