Soil Sample Pseudomonas aeruginosa
Classification
- Domain: Bacteria
- Phylum: Proteobacteria
- Class: Gamma Proteobacteria
- Order: Pseudomonadales
- Family: Pseudomonadaceae
- Genus: Pesudomonas
Species
NCBI: Taxonomy |
Pseudomonas aeruginosa
Habitat Information
The location of the soil sample was collected behind an apartment complex inside of a ditch. Due to recent rain of approximately two days the soil was silty clay, with 1 to 3 percent slopes. The depth of digging was from the surface to 2 1/2".
Date of Collection: 1/29/2015
Location: 289 Spring Lane Dripping Springs, TX 78620
Air temperature: 60 degrees F
Humidity: 40%
24-hr Rainfall: 20%
Latitude/Longitude: 26.4384N 21.0792W
Solar Radiation: 15.63
Description and Significance
Pseudomonas aeruginosa is a gram negative opportunistic bacteria that can be found in soil, water, plants, animals, humans, hospitals and other places that contain moisture. Colony morphology is pale brown/metallic sheen color, flat, irregular, entire smooth appearance, sweet corn tortilla odor. The cellular shape of P. aeruginosa is gram negative bacilli rods, motile, obligate aerobes. P.aeruginosa is the very common cause of infections naturally resistant to a large range of antibiotics. Immunocompromised patients with cancer, HIV/AIDS, cystic fibrosis, hospitalized patients, and individuals in the burn unit at a hospital as well are at a bigger risk contracting this bacteria.
Genome Structure
P.aeruginosa has a genome size of 5.2 to 7 million base pairs(Mbp) with 65% Guanine and Cytosine content. It has a single and supercoiled circular chromosome in the cytoplasm and variable number of plasmids.
Pseudomonas aeruginosa strain DKBI 16S Ribosomal RNA gene partial sequence Max Score: 1310 Query cover: 100% Ident: 99% Accession: KM978038.1
AGCACCTGTGTCTGAGTTCCCGAAGGCACCAATCCATCTCTGGAAAGTTCTCAGCATGTCAAGGCC AGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTT TAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTATCGCGTTAGCTGCGCCACTAAGATCTCAAGGATCCCAACGGCTA GTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTAT CAGTCCAGGTGGTCGCCTTCGCCACTGGTGTTCCTTCCTATATCTACGCATTTCACCGCTACACAGGAAATTCCACCACC CTCTACCGTACTCTAGCTCAGTAGTTTTGGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCCAACTTGCTGAACC ACCTACGCGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAG CCGGTGCTTATTCTGTTGGTAACGTCAAAACAGCAAGGTATTAACTTACTGCCCTTCCTCCCAACTTAAAGTGCTTTACA ATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTGCTGCCACC
Cell Structure, Metabolism and Life Cycle
P.aeruginosa is a gram begative bacteria with an outer membrane that contains Protein F (OprF) that functions as prion which allows certain molecules and ions to come into the cells, and as a structural protein, it maintains the bacterial cell shape. Protein F provides the outer membrane with an exclusion limit which lowers permeability, which is a property that is desired because it decreases the intake of harmful substances into the cell, and causes resistance to antibiotics. This bacteria also uses
Physiology and Pathogenesis
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.
References
Author
Page authored by Priscilla Martinez, student of Prof. Kristine Hollingsworth at Austin Community College.