Sporothrix schenckii

From MicrobeWiki, the student-edited microbiology resource

A Microbial Biorealm page on the genus Sporothrix schenckii

Classification(1)

Higher order taxa

cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Sordariomycetidae; Ophiostomatales; Ophiostomataceae; mitosporic Ophiostomataceae; Sporothrix

Species

NCBI: Taxonomy

Sporothrix schenckii

Genetic Code

Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3  = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Description and significance

Describe the appearance, habitat, etc. of the organism, and why it is important enough to have its genome sequenced. Describe how and where it was isolated. Include a picture or two (with sources) if you can find them.

Genome structure

Describe the size and content of the genome. How many chromosomes? Circular or linear? Other interesting features? What is known about its sequence? Does it have any plasmids? Are they important to the organism's lifestyle?

Cell structure and metabolism

Describe any interesting features and/or cell structures; how it gains energy; what important molecules it produces.

Ecology

Describe any interactions with other organisms (included eukaryotes), contributions to the environment, effect on environment, etc.

Pathology

How does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.

Application to Biotechnology

Does this organism produce any useful compounds or enzymes? What are they and how are they used?

Current Research

Enter summaries of the most recent research here--at least three required

References

[Sample reference] Takai, K., Sugai, A., Itoh, T., and Horikoshi, K. "Palaeococcus ferrophilus gen. nov., sp. nov., a barophilic, hyperthermophilic archaeon from a deep-sea hydrothermal vent chimney". International Journal of Systematic and Evolutionary Microbiology. 2000. Volume 50. p. 489-500.

Edited by student of Rachel Larsen