Aeromonas media

From MicrobeWiki, the student-edited microbiology resource
Jump to: navigation, search
This student page has not been curated.

Classification

Bacteria (Kingdom); Proteobacteria (Phylum); Gammaproteobacteria (Class); Aeromonadales (Order); Aeromonadaceae (Family); Aeromonas (Genus); Aeromonas caviae (Phenotypic Group)

Species

NCBI: Taxonomy

Aeromonas media

Habitat Information

The sample was collected from an area containing mostly Houston Black soil at a depth of approximately 1". It was a high traffic area in direct sunlight and the ground had been slightly disturbed.

  • TEMP: 55°F
  • HUMIDITY:
  • 24-hr RAINFALL: 0.0in
  • PRESSURE: 29.93in

Description and Significance

Aeromonas media colonies are dull, off-white in color and round while slightly raised with an entire margin. On the cellular level it is a gram-negative rod-shaped bacteria, 1 by 2 μm in size with rounded ends that are not grouped together in any particular way. There are no antimicrobial properties known at this time and while much is known about other species of this genus, there is little significance given to this particular one. However, a strain producing high levels of DOPA-melanin known as Aeromonas media WS has recently surfaced and potentially could be useful in bioinsecticides.

Genome Structure

Scientists think they have managed to map the entire genome of many of the species of Aeromonas, including Aeromonas media. This bacteria contains a circular chromosome with a length of 4,777,154 base pairs and a circular plasmid (pWSY) consisting of 11,276 base pairs. Its genome also contains 4,788,430 nucleotides, 4385 protein genes and 156 RNA genes. This is the sequence obtained through PCR after isolation of the organism: GCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGTTGATGCCTAATACGCATCAGCTGTGACGTTACTCGCAGAAGAAGCACCGGC TAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGGATAAGT TAGATGTGAAAGCCCCGGGCTCACCCTGGGAATTGCATTTAAAACTGTCCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCGGGGGTAGC GGTGGCCTGCGCCGTCGTCTGTCCTTTATGTTTACCCTGTCCCGCTACTTAAAAAATACCACCGAATCCACCTTCCTCTTACTCA ATTCTTTGGATGCAGTTGGGAAGTGACCCCGGGGAATTCAATCCTTTTGCTGAACCACAACACGCGCCTTAGCCCCTTAAATCCTTAA CTCTTAACCTC


Cell Structure, Metabolism and Life Cycle

Although very similar to the pathogenic strains, Aeromonas media's lack of several adhesion abilities and toxin production help set it apart. Being a gram-negative bacteria, it has a thin layer of peptidoglycan sandwiched between an outer membrane made of lipopolysaccharides and an inner cytoplasmic membrane. Most have a single polar flagellum and do not produce endospores or have protective capsules. It is a facultative anaerobe capable of surviving by fermentation or through use of oxygen.

Physiology and Pathogenesis

  • MSA: neg
  • Blood Agar: α and β hemolysis
  • PEA: neg
  • Salt Tolerance: neg
  • Bile Esculin: pos for growth, pos for Esculin hydrolysis
  • Citrate: neg
  • SIM: pos for motility, neg for Indole fermentation, neg for Sulfur reduction
  • TSI: pos for glucose and lactose and/or sucrose fermentation, no gas production or Sulfur reduction
  • Nitrate: neg for Nitrate to Nitrite, pos for Nitrate to gas
  • MR: pos
  • VP: neg
  • Urease: pos
  • Catalase: neg

In the antibiotic/disinfectant tests it showed susceptibility to only 100% Bleach and Azlocillin. Even though Aeromonas media showed strong resistance to 3/4 anibiotics, it is a non-pathogenic species.

References

http://www.genome.jp/kegg-bin/show_organism?org=amed

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC156557/

https://microbewiki.kenyon.edu/index.php/Aeromonas

http://www.ncbi.nlm.nih.gov/nuccore/CP007567

http://www.ncbi.nlm.nih.gov/nuccore/CP007568

http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2672.2007.03502.x/full

https://catalog.hardydiagnostics.com/cp_prod/Content/hugo/Aeromonas.htm


Author

Page authored by James MacFarland, student of Prof. Kristine Hollingsworth at Austin Community College.