JJDZ Soil

This student page has not been curated.

[1]

Classification

Domain: Bacteria
Phylum: Proteobacteria
Class: Gammaproteobacteria
Order: Enterobacterales
Family: Enterobacteriaceae

Species

[2]

Escherichia coli
NCBI Link: Escherichia coli Taxonomy: [3]

Habitat Information

Soil Sample Location: Copperfield Park and Greenbelt - 1425 E Yager Ln, Austin, TX 78753
Soil Collection Date & time: 9/7/2017 @ 10:00 AM

Conditions Present at time of soil collection:
- No recent rain within past 48 hours
- Temperature was 71 degrees F

Soil sample was retrieved at a depth of roughly 3 inches and about 6-8 inches from creek bed.

Description of Area:
- Pond and creek area
- Moderate erosion
- Wildlife present (actually saw a coyote when collecting sample)
- Area was damp and wet (close to creek bed)
- Area gets roughly 1/2 day of sunlight everyday

Description and Significance

Colonial Appearance:
- Shape: Circular
- Margin: Entire
- Elevation: Raised
- Size: Punctiform, small
- Texture: Smooth
- Appearance: Shiny
- Pigmentation: Non-pigmented / colorless
- Optical Property: Translucent

As gram-negative organisms, E. coli are resistant to many antibiotics. Antibiotics which may be used to treat E. coli infection include amoxicillin, penicillins, many cephalosporins, carbapenems, and the aminoglycosides.

Antibiotic resistance in E. coli is of particular concern because it is the most common Gram-negative pathogen in humans, the most common cause of urinary tract infections, a common cause of both community and hospital-acquired bacteraemia as well as a cause of diarrhea. In addition, resistant E. coli strains have the ability to transfer antibiotic resistance not only to other strains of E.coli, but also to other bacteria within the gastrointestinal tract and to acquire resistance from other organisms. [4]

Genome Structure

E. coli has only one circular chromosome

Nucleotide Genome Sequence: GCACCTGTCTCACGGTTCCCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTT TTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCNNCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCG

Escherichia coli strain S17-13, complete genome

           Genes (total)          :: 5,359
           CDS (total)            :: 5,234
           Genes (coding)         :: 4,987
           CDS (coding)           :: 4,987
           Genes (RNA)            :: 125
           rRNAs                  :: 8, 7, 7 (5S, 16S, 23S)
           complete rRNAs         :: 8, 7, 7 (5S, 16S, 23S)
           tRNAs                  :: 90
           ncRNAs                 :: 13

NCBI Link: E. coli Strain S17-13: [5]

Cell Structure, Metabolism and Life Cycle

Cell Structure: E. Coli is a Gram-negative, facultatively anaerobic, rod-shaped, coliform bacterium. [6]. It also possesses adhesive fimbriae and a cell wall that consists of an outer membrane containing lipopolysaccharides, a periplasmic space with a peptidoglycan layer, and an inner, cytoplasmic membrane. [7]. The integument, the tough outer protective layer, protects the bacterium from other organisms or oppressors.

Metabolism: E.coli has fairly simple nutritional requirements. It is a heterotrophic organism, therefor it cannot produce its own food and it must obtain nutrition and energy by taking it from other organisms, most often its host. Carbon is very important to e-coli, and it obtains its carbon from glucose. Glucose is the preferred and most frequently available energy source for E. coli. The enzymes to metabolize glucose are made constantly by E. coli. [8]

Reproduction Cycle: E-coli has a very rapid growth cycle; it reproduces by either cell (binary) division (asexual) or through conjugation (sex pilus), the most common reproductive method is asexual reproduction. The time required for a complete cycle varies depending on several factors, however in optimal nutrient conditions, E. Coli can duplicate in about 20 minutes.

Physiology and Pathogenesis

Biochemical characteristics of E. coli:

Characteristic Reactions
Tests	E-Coli	In class results of organism
MacConkey agar	LF positive, bright pink mucoid and bile precipitate	LF negative, no growth, no fermentation
Lactose	Acid+, gas+	Acid+, gas+
Mannitol Fermentation	positive, usually with gas	Negative
Methyl-Red	Positive	Negative
Voges-Proskauer	Negative	Positive
Catalase	Positive	Positive
Oxidase	Negative	Negative
Citrate	Negative	Negative
Mannitol	Positive	Negative for fermentation - organism growth
Urea	No hydrolysis	No hydrolysis
Gelatin Liquefaction	Negative	Positive
Hemolysis (Alfa/Beta/Gamma)	Some Strains show Hemolysis	Beta Hemolysis
DNase	Negative	Positive
Mannitol	Positive	Negative Fermentation / Organism grew
Bacitracin	Negative	Negative
Optochin	Negative	Negative

Organism Significance:
- E-Coli is typically harmless and lives in gut flora within mammal’s intestines. Most types of E. coli are harmless and even help keep your digestive tract healthy. It produces Vitamin K2 and It normally exists symbiotic relationships with pathogenic bacteria. E-coli is expelled into the environment through fecal matter. Some strains can cause serious food poisoning in humans if food or drinks get contaminated. An example is the Shiga toxin-producing E. coli (STEC), it can cause severe food-borne disease. [9]. It is transmitted to humans primarily through consumption of contaminated foods, such as raw or under cooked ground meat products, raw milk, and contaminated raw vegetables and sprouts & ground beef. When cattle are slaughtered and processed, E. coli bacteria in their intestines can get on the meat, unpasteurized milk, fresh produce
- E. coli comprises an extremely large population of bacteria that display a very high amount of genetic and phenotypic diversity. There has been extensive genome sequencing of a large number of E. coli strains, it is reasonable to say that it needs a new taxonomic classification.
- Uropathogenic E. coli (UPEC) is responsible for approximately 90% of urinary tract infections. [10]

Contributing factors to environment:
- The sustainability of land and water resources is under pressure due to growing demands on agricultural systems to deliver food for an increasing world population. One source of pressure can be attributed to livestock agriculture and the production of large volumes of feces and associated manures. If managed effectively, fecal contributions to agricultural land from livestock can serve as a valuable farm resource and organic fertilizer, but if mismanaged and combined with opportunities for hydro-logical transfer, they can threaten water quality draining from catchment systems with a range of pollutants.

Virulent factors: the more virulence factors a strain has, the more severe the infection can be.
- They use an adhesin known as intimin to bind host intestinal cells
- Bacterial frimbriae for attachment
- Produce enterotoxins

Symptoms and disease in human hosts: Symptoms will vary dependent on the strain. Symptoms can be mild and some can lead to organ failure and even death.
- Common symptoms are diarrhea, fever
- Serious symptoms are bloody diarrhea, kidney failure, meningitis in neonates

Symptoms and disease in animal hosts: the more virulent strains are capable of many diseases especially in cows and poultry
- Septicemia, Diarrhea, Mastitis (utter infection) in bovine
- Respiratory disease common in poultry