Soil Project- English/Ramos: Difference between revisions

From MicrobeWiki, the student-edited microbiology resource
Jump to navigationJump to search
 
(55 intermediate revisions by the same user not shown)
Line 2: Line 2:
==Classification==
==Classification==


Domain; Phylum; Class; Order; family [Others may be used.  Use [http://www.ncbi.nlm.nih.gov/Taxonomy/ NCBI] link to find]
 
 
Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus
 


===Species===
===Species===
Fictibacillus sp
''Genus species''
Classification
Bacillus Arsenicus also known as Fictibacillus arsenicus


{|
{|
Line 11: Line 21:
|}
|}


''Genus species''
Microbiology


==Habitat Information ==
==Habitat Information ==
Describe the location and conditions under which the organism was isolated.
Describe the location and conditions under which the organism was isolated.
Collection Date: September 7, 2017
Air Temp: 76%
Humidity: 36%
24Hr Rainfall: 0.00
Pressure: 30.03”
Solar Radiation: 22.53
Depth of collection: surface to 1 inch deep
Grid Coordinates: Lat 29.9425576 Long -98.4037259
Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.


==Description and Significance==
==Description and Significance==
Describe the appearance (colonial and cellular), possible antimicrobial activity etc. of the organism, and why the organism might be significant.
 
 
'''Colony Morphology'''
 
Margin: Smooth
 
Elevation: convex
 
Surface: smooth
 
Color: very light greenish tan
 
Soluble Pigment: opaque
 
 
'''Cellular morphology:'''
 
Gram positive rods  in long chains.
 
Possible microbial activity:
The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.
 
'''Significance'''
 
Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes.
Arsenic resistant bacterium
 
 
[[File:Soil_microorganism.png]]


==Genome Structure==
==Genome Structure==
Describe the size and content of the genome. 
 
How many chromosomes? 
 
Circular or linear? 
The soil microorganism was sent to a lab for sequencing and this was the result:
Other interesting features? 
What is known about its sequence? The soil microorganism was sent to a lab for sequencing and this was the result:
AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC
AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC
TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC
TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC
Line 33: Line 87:
GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA
GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA


Include S Ribosomal sequence that you obtained from PCR and sequencing here.
 
Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result:
 
Select seq KM598247.1
Fictibacillus sp.
THG-SQK1
16S ribosomal RNA gene,
partial sequence
 
 
RID
 
2NMY0NWT015 (Expires on 12-10 01:02 am)
 
Query ID
 
lcl|Query_140973
 
Description
 
None
 
Molecule type
 
nucleic acid
 
Query Length
553
 
Database Name
 
nr
 
Description
 
Nucleotide collection (nt) Program
 
BLASTN 2.7.1+


==Cell Structure, Metabolism and Life Cycle==
==Cell Structure, Metabolism and Life Cycle==
Interesting features of cell structure; how it gains energy; what important molecules it produces.
From an internet research this is what we found on our soil microorganism:
On October 20th, 2017; we used LB broth that had been previously cultured the week prior with one small colony of our soil microorganism. Using this broth we performed chemical tests and these were the results:
 
1. Inoculated Methyl Red and Voges-Proskauer broth to test for fermentation. Result: Negative; it did not produce mixed acid fermentation and it did not convert glucose to neutral end products.
Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.
2. Citrate test. Using a Simmons Citrate slant and an inoculating needle stabbed the slant and streaked the slant. Result: Negative; it does not use Citrate as its only carbon source.
 
3. Sulfur Indole Motility Test (SIM): Result: Negative. It does not produce Indole, it does not reduce sulfur and it is non-motile.
The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile.
4. Nitrate reduction test. Using a Nitrate broth tube, inoculated with our microorganism. The result of the first step the reaction was Negative; this meant it did not reduce nitrates. So we went to the second step adding Zinc powder. This result was Negative as well; The result is the microorganism does not convert Nitrate to Nitrite neither to other end products. Negative for Nitrate or other end products.
After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.
5. Urea Hydrolysis Test. Inoculated a urea broth tube.  Result: Negative; it cannot convert Urea to ammonia.
 
6. Triple Iron Sugar (TSI) test. Inoculateda TSI slant. Our soil microorganism was negative for fermentation.
Gram positive cell structure:
 
From results found in lab, organism was found to be gram positive.  
Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane.


==Physiology and Pathogenesis==
==Physiology and Pathogenesis==
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
 
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>
 
Enzyme produced: casein
 
Biochemical characteristics based on Chemical testing on the soil microorganism:
 
October 6th tests:
 
Phenol Red Broth: Negative for fermentation.
 
Starch Hydrolysis test: Negative.
 
'''Casein Hydrolysis Test: Positive'''.
 
[[File:Casein_Hydrolisis.png]]
 
Gelatin Hydrolysis test: negative.
 
DNA hydrolysis: Negative.
 
Lipid hydrolysis: Negative.
 
October 20th:
 
Methyl Red and Voges-Proskauer: Negative.
 
Citrate test: Negative.
 
SIM medium test: Negative.
 
Nitrate reduction: Negative (first step and second step also negative).
 
Urea Hydrolysis test: Negative.
 
Triple Iron Sugar test: Negative for fermentation.
 
Oct. 27th tests:
 
Oxidase test: Negative.
 
MacConkey Agar test: Negative.
 
Eosin Methylene Blue agar test: Negative.
 
Hektoen Enteric Agar test: Negative.
 
Decarboxylation test: Negative.
 
Phenylalanine Deaminase Test: negative.
 
Nov 3rd:
 
'''Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.'''
 
Manitol salt agar: Negative.
 
'''Phenylethyl Alcohol Agar (PEA): Positive,''' the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.
 
'''Catalase test: Positive'''. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.
Salt tolerance test: Negative.
 
Bile Esculin test: Negative.
 
Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.
 
Nov 10th
 
Antimicrobial susceptibility test (Kirby-Bauer method):
soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam; 
Resistant to: Cefoxitin and Ceftazidime.
 
Disinfectants: highly sensitive to 100% Bleach.
Somewhat sensitive to Lavender, 5% Bleach and Rosemary.
Not sensitive to orange.[[File:Disinfectant_susceptibility.png]]
 
[[File:Antimicrobial_susceptibility.png]]


==References==
==References==
[Sample reference] [http://ijs.sgmjournals.org/cgi/reprint/50/2/489 Takai, K., Sugai, A., Itoh, T., and Horikoshi, K. "''Palaeococcus ferrophilus'' gen. nov., sp. nov., a barophilic, hyperthermophilic archaeon from a deep-sea hydrothermal vent chimney". ''International Journal of Systematic and Evolutionary Microbiology''. 2000. Volume 50. p. 489-500.]
 
Genome sequence obtained from DNA BLAST web site https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
https://blast.ncbi.nlm.nih.gov/Blast.cgi
 
 
Pictures taken in class.
 
References
 
Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus
Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0


==Author==
==Author==

Latest revision as of 19:40, 8 December 2017

This student page has not been curated.

Classification

Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus


Species

Fictibacillus sp


Genus species Classification Bacillus Arsenicus also known as Fictibacillus arsenicus

NCBI: Taxonomy

Microbiology

Habitat Information

Describe the location and conditions under which the organism was isolated.

Collection Date: September 7, 2017

Air Temp: 76%

Humidity: 36%

24Hr Rainfall: 0.00

Pressure: 30.03”

Solar Radiation: 22.53

Depth of collection: surface to 1 inch deep

Grid Coordinates: Lat 29.9425576 Long -98.4037259

Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.

Description and Significance

Colony Morphology

Margin: Smooth

Elevation: convex

Surface: smooth

Color: very light greenish tan

Soluble Pigment: opaque


Cellular morphology:

Gram positive rods in long chains.

Possible microbial activity: The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.

Significance

Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes. Arsenic resistant bacterium


Genome Structure

The soil microorganism was sent to a lab for sequencing and this was the result: AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC AACACCTAGNACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCACCCCACGCTTTCGCGCCTCAGC GTCAGTTACAGGCCAAAAAGCCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATT CCACTTTTCTCTCCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTT AGGAGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCNGATAACGCTTGCCACCTACGTATTACCGCGGCTGCTGGCAC GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA


Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result:

Select seq KM598247.1 Fictibacillus sp. THG-SQK1 16S ribosomal RNA gene, partial sequence


RID

2NMY0NWT015 (Expires on 12-10 01:02 am)

Query ID

lcl|Query_140973

Description

None

Molecule type

nucleic acid

Query Length 553

Database Name

nr

Description

Nucleotide collection (nt) Program

BLASTN 2.7.1+

Cell Structure, Metabolism and Life Cycle

From an internet research this is what we found on our soil microorganism:

Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.

The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile. After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.

Gram positive cell structure:

From results found in lab, organism was found to be gram positive. Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane.

Physiology and Pathogenesis

Enzyme produced: casein

Biochemical characteristics based on Chemical testing on the soil microorganism:

October 6th tests:

Phenol Red Broth: Negative for fermentation.

Starch Hydrolysis test: Negative.

Casein Hydrolysis Test: Positive.

Gelatin Hydrolysis test: negative.

DNA hydrolysis: Negative.

Lipid hydrolysis: Negative.

October 20th:

Methyl Red and Voges-Proskauer: Negative.

Citrate test: Negative.

SIM medium test: Negative.

Nitrate reduction: Negative (first step and second step also negative).

Urea Hydrolysis test: Negative.

Triple Iron Sugar test: Negative for fermentation.

Oct. 27th tests:

Oxidase test: Negative.

MacConkey Agar test: Negative.

Eosin Methylene Blue agar test: Negative.

Hektoen Enteric Agar test: Negative.

Decarboxylation test: Negative.

Phenylalanine Deaminase Test: negative.

Nov 3rd:

Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.

Manitol salt agar: Negative.

Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.

Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.

Salt tolerance test: Negative.

Bile Esculin test: Negative.

Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.

Nov 10th

Antimicrobial susceptibility test (Kirby-Bauer method):

soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;  

Resistant to: Cefoxitin and Ceftazidime.

Disinfectants: highly sensitive to 100% Bleach. Somewhat sensitive to Lavender, 5% Bleach and Rosemary. Not sensitive to orange.

References

Genome sequence obtained from DNA BLAST web site https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch https://blast.ncbi.nlm.nih.gov/Blast.cgi


Pictures taken in class.

References

Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0

Author

Page authored by Tara English and Teresa Ramos, students of Prof. Kristine Hollingsworth at Austin Community College.