Soil Project- English/Ramos: Difference between revisions

From MicrobeWiki, the student-edited microbiology resource
Jump to navigationJump to search
 
(15 intermediate revisions by the same user not shown)
Line 2: Line 2:
==Classification==
==Classification==


Domain; Phylum; Class; Order; family [Others may be used.  Use [http://www.ncbi.nlm.nih.gov/Taxonomy/ NCBI] link to find]
 
 
Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus
 


===Species===
===Species===
Fictibacillus sp
''Genus species''
Classification
Bacillus Arsenicus also known as Fictibacillus arsenicus


{|
{|
Line 11: Line 21:
|}
|}


''Genus species''
Microbiology
Classification
Bacillus Arsenicus also known as Fictibacillus arsenicus
Phylum: Firmicutes
Genus: Bacillus
Order: Bacillales
Species: B. arsenicus


==Habitat Information ==
==Habitat Information ==
Describe the location and conditions under which the organism was isolated.
Describe the location and conditions under which the organism was isolated.
Collection Date: September 7, 2017
Collection Date: September 7, 2017
Air Temp: 76%
Air Temp: 76%
Humidity: 36%
Humidity: 36%
24Hr Rainfall: 0.00
24Hr Rainfall: 0.00
Pressure: 30.03”
Pressure: 30.03”
Solar Radiation: 22.53
Solar Radiation: 22.53
Depth of collection: surface to 1 inch deep
Depth of collection: surface to 1 inch deep
Grid Coordinates: Lat 29.9425576 Long -98.4037259
Grid Coordinates: Lat 29.9425576 Long -98.4037259
Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.
Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.


==Description and Significance==
==Description and Significance==
Describe the appearance (colonial and cellular), possible antimicrobial activity etc. of the organism, and why the organism might be significant.
 


'''Colony Morphology'''
'''Colony Morphology'''


Margin: Smooth
Margin: Smooth
Elevation: convex
Elevation: convex
Surface: smooth
Surface: smooth
Color: very light green
 
Color: very light greenish tan
 
Soluble Pigment: opaque
Soluble Pigment: opaque


'''Cellular morphology:'''
'''Cellular morphology:'''
Line 47: Line 65:


Possible microbial activity:
Possible microbial activity:
The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.
The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.


'''Significance'''
'''Significance'''
Line 58: Line 76:


==Genome Structure==
==Genome Structure==
Describe the size and content of the genome. 
 
How many chromosomes? 
Circular or linear? 
Other interesting features? 
What is known about its sequence?


The soil microorganism was sent to a lab for sequencing and this was the result:
The soil microorganism was sent to a lab for sequencing and this was the result:
Line 73: Line 87:
GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA
GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA


Include S Ribosomal sequence that you obtained from PCR and sequencing here.
 
Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result:
 
Select seq KM598247.1
Fictibacillus sp.
THG-SQK1
16S ribosomal RNA gene,
partial sequence
 
 
RID
 
2NMY0NWT015 (Expires on 12-10 01:02 am)
 
Query ID
 
lcl|Query_140973
 
Description
 
None
 
Molecule type
 
nucleic acid
 
Query Length
553
 
Database Name
 
nr
 
Description
 
Nucleotide collection (nt) Program
 
BLASTN 2.7.1+


==Cell Structure, Metabolism and Life Cycle==
==Cell Structure, Metabolism and Life Cycle==
Interesting features of cell structure; how it gains energy; what important molecules it produces.
From an internet research this is what we found on our soil microorganism:


Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.
Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.
Line 82: Line 133:
The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile.
The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile.
After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.
After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.
Gram positive cell structure:
From results found in lab, organism was found to be gram positive.
Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane.


==Physiology and Pathogenesis==
==Physiology and Pathogenesis==
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
 
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>


Enzyme produced: casein
Enzyme produced: casein
Line 92: Line 147:


October 6th tests:
October 6th tests:
Phenol Red Broth: Negative for fermentation.
Phenol Red Broth: Negative for fermentation.
Starch Hydrolysis test: Negative.
Starch Hydrolysis test: Negative.


Line 100: Line 157:


Gelatin Hydrolysis test: negative.
Gelatin Hydrolysis test: negative.
DNA hydrolysis: Negative.
DNA hydrolysis: Negative.
Lipid hydrolysis: Negative.
Lipid hydrolysis: Negative.
October 20th:
October 20th:
Methyl Red and Voges-Proskauer: Negative.
Methyl Red and Voges-Proskauer: Negative.
Citrate test: Negative.
Citrate test: Negative.
SIM medium test: Negative.
SIM medium test: Negative.
Nitrate reduction: Negative (first step and second step also negative).
Nitrate reduction: Negative (first step and second step also negative).
Urea Hydrolysis test: Negative.
Urea Hydrolysis test: Negative.
Triple Iron Sugar test: Negative for fermentation.
Triple Iron Sugar test: Negative for fermentation.
Oct. 27th tests:
Oct. 27th tests:
Oxidase test: Negative.
Oxidase test: Negative.
MacConkey Agar test: Negative.
MacConkey Agar test: Negative.
Eosin Methylene Blue agar test: Negative.
Eosin Methylene Blue agar test: Negative.
Hektoen Enteric Agar test: Negative.
Hektoen Enteric Agar test: Negative.
Decarboxylation test: Negative.
Decarboxylation test: Negative.
Phenylalanine Deaminase Test: negative.
Phenylalanine Deaminase Test: negative.
Nov 3rd:
Nov 3rd:
'''Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.'''
'''Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.'''
Manitol salt agar: Negative.
Manitol salt agar: Negative.
Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.
 
'''Catalase test: Positive'''. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.  
'''Phenylethyl Alcohol Agar (PEA): Positive,''' the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.
 
'''Catalase test: Positive'''. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.
Salt tolerance test: Negative.
Salt tolerance test: Negative.
Bile Esculin test: Negative.
Bile Esculin test: Negative.
Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.
Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.
Nov 10th
Nov 10th
Antimicrobial susceptibility test (Kirby-Bauer method):
Antimicrobial susceptibility test (Kirby-Bauer method):
  soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;   
  soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;   
Resistant to: Cefoxitin and Ceftazidime.
Resistant to: Cefoxitin and Ceftazidime.
Disinfectants: highly sensitive to 100% Bleach.
Disinfectants: highly sensitive to 100% Bleach.
Somewhat sensitive to Lavender, 5% Bleach and Rosemary.
Somewhat sensitive to Lavender, 5% Bleach and Rosemary.
Line 141: Line 225:


Pictures taken in class.
Pictures taken in class.
References
References
Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus
Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus
Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0
Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0

Latest revision as of 19:40, 8 December 2017

This student page has not been curated.

Classification

Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus


Species

Fictibacillus sp


Genus species Classification Bacillus Arsenicus also known as Fictibacillus arsenicus

NCBI: Taxonomy

Microbiology

Habitat Information

Describe the location and conditions under which the organism was isolated.

Collection Date: September 7, 2017

Air Temp: 76%

Humidity: 36%

24Hr Rainfall: 0.00

Pressure: 30.03”

Solar Radiation: 22.53

Depth of collection: surface to 1 inch deep

Grid Coordinates: Lat 29.9425576 Long -98.4037259

Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.

Description and Significance

Colony Morphology

Margin: Smooth

Elevation: convex

Surface: smooth

Color: very light greenish tan

Soluble Pigment: opaque


Cellular morphology:

Gram positive rods in long chains.

Possible microbial activity: The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.

Significance

Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes. Arsenic resistant bacterium


Genome Structure

The soil microorganism was sent to a lab for sequencing and this was the result: AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC AACACCTAGNACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCACCCCACGCTTTCGCGCCTCAGC GTCAGTTACAGGCCAAAAAGCCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATT CCACTTTTCTCTCCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTT AGGAGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCNGATAACGCTTGCCACCTACGTATTACCGCGGCTGCTGGCAC GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA


Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result:

Select seq KM598247.1 Fictibacillus sp. THG-SQK1 16S ribosomal RNA gene, partial sequence


RID

2NMY0NWT015 (Expires on 12-10 01:02 am)

Query ID

lcl|Query_140973

Description

None

Molecule type

nucleic acid

Query Length 553

Database Name

nr

Description

Nucleotide collection (nt) Program

BLASTN 2.7.1+

Cell Structure, Metabolism and Life Cycle

From an internet research this is what we found on our soil microorganism:

Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.

The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile. After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.

Gram positive cell structure:

From results found in lab, organism was found to be gram positive. Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane.

Physiology and Pathogenesis

Enzyme produced: casein

Biochemical characteristics based on Chemical testing on the soil microorganism:

October 6th tests:

Phenol Red Broth: Negative for fermentation.

Starch Hydrolysis test: Negative.

Casein Hydrolysis Test: Positive.

Gelatin Hydrolysis test: negative.

DNA hydrolysis: Negative.

Lipid hydrolysis: Negative.

October 20th:

Methyl Red and Voges-Proskauer: Negative.

Citrate test: Negative.

SIM medium test: Negative.

Nitrate reduction: Negative (first step and second step also negative).

Urea Hydrolysis test: Negative.

Triple Iron Sugar test: Negative for fermentation.

Oct. 27th tests:

Oxidase test: Negative.

MacConkey Agar test: Negative.

Eosin Methylene Blue agar test: Negative.

Hektoen Enteric Agar test: Negative.

Decarboxylation test: Negative.

Phenylalanine Deaminase Test: negative.

Nov 3rd:

Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.

Manitol salt agar: Negative.

Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.

Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.

Salt tolerance test: Negative.

Bile Esculin test: Negative.

Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.

Nov 10th

Antimicrobial susceptibility test (Kirby-Bauer method):

soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;  

Resistant to: Cefoxitin and Ceftazidime.

Disinfectants: highly sensitive to 100% Bleach. Somewhat sensitive to Lavender, 5% Bleach and Rosemary. Not sensitive to orange.

References

Genome sequence obtained from DNA BLAST web site https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch https://blast.ncbi.nlm.nih.gov/Blast.cgi


Pictures taken in class.

References

Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0

Author

Page authored by Tara English and Teresa Ramos, students of Prof. Kristine Hollingsworth at Austin Community College.