Soil Project- English/Ramos: Difference between revisions

From MicrobeWiki, the student-edited microbiology resource
Jump to navigationJump to search
Line 48: Line 48:
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).<br>
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.<br><br>
October 6th tests:
Phenol Red Broth: Negative for fermentation
Starch Hydrolysis test: Negative
Casein Hydrolysis Test: Positive
Gelatin Hydrolysis test: negative
DNA hydrolysis: Negative
Lipid hydrolysis: Negative
October 20th:
Methyl Red and Voges-Proskauer: Negative
Citrate test: Negative
SIM medium test: Negative
Nitrate reduction: Negative (first step and second step also negative).
Urea Hydrolysis test: Negative
Triple Iron Sugar test: Negative for fermentation
Oct. 27th tests:
Oxidase test: Negative
MacConkey Agar test: Negative
Eosin Methylene Blue agar test: Negative
Hektoen Enteric Agar test: Negative
Decarboxylation test: Negative
Phenylalanine Deaminase Test: negative
Nov 3rd:
Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.
Manitol salt agar: Negative
Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.
Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.
Salt tolerance test: Negative
Bile Esculin test: Negative
Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.
Nov 10th
Antimicrobial susceptibility test (Kirby-Bauer method):
soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam; 
Resistant to: Cefoxitin and Ceftazidime.
Disinfectants: highly sensitive to 100% Bleach
Somewhat sensitive to Lavender, 5% Bleach and Rosemary.
Not sensitive to orange.


==References==
==References==

Revision as of 05:11, 6 December 2017

This student page has not been curated.

Classification

Domain; Phylum; Class; Order; family [Others may be used. Use NCBI link to find]

Species

NCBI: Taxonomy

Genus species

Habitat Information

Describe the location and conditions under which the organism was isolated.

Description and Significance

Describe the appearance (colonial and cellular), possible antimicrobial activity etc. of the organism, and why the organism might be significant.

Genome Structure

Describe the size and content of the genome. How many chromosomes? Circular or linear? Other interesting features? What is known about its sequence? The soil microorganism was sent to a lab for sequencing and this was the result: AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC AACACCTAGNACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCACCCCACGCTTTCGCGCCTCAGC GTCAGTTACAGGCCAAAAAGCCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATT CCACTTTTCTCTCCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTT AGGAGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCNGATAACGCTTGCCACCTACGTATTACCGCGGCTGCTGGCAC GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA

Include S Ribosomal sequence that you obtained from PCR and sequencing here.

Cell Structure, Metabolism and Life Cycle

Interesting features of cell structure; how it gains energy; what important molecules it produces. On October 20th, 2017; we used LB broth that had been previously cultured the week prior with one small colony of our soil microorganism. Using this broth we performed chemical tests and these were the results: 1. Inoculated Methyl Red and Voges-Proskauer broth to test for fermentation. Result: Negative; it did not produce mixed acid fermentation and it did not convert glucose to neutral end products. 2. Citrate test. Using a Simmons Citrate slant and an inoculating needle stabbed the slant and streaked the slant. Result: Negative; it does not use Citrate as its only carbon source. 3. Sulfur Indole Motility Test (SIM): Result: Negative. It does not produce Indole, it does not reduce sulfur and it is non-motile. 4. Nitrate reduction test. Using a Nitrate broth tube, inoculated with our microorganism. The result of the first step the reaction was Negative; this meant it did not reduce nitrates. So we went to the second step adding Zinc powder. This result was Negative as well; The result is the microorganism does not convert Nitrate to Nitrite neither to other end products. Negative for Nitrate or other end products. 5. Urea Hydrolysis Test. Inoculated a urea broth tube. Result: Negative; it cannot convert Urea to ammonia. 6. Triple Iron Sugar (TSI) test. Inoculateda TSI slant. Our soil microorganism was negative for fermentation.

Physiology and Pathogenesis

Biochemical characteristics, enzymes made, other characteristics that may be used to identify the organism; contributions to environment (if any).
If relevant, how does this organism cause disease? Human, animal, plant hosts? Virulence factors, as well as patient symptoms.

October 6th tests: Phenol Red Broth: Negative for fermentation Starch Hydrolysis test: Negative Casein Hydrolysis Test: Positive Gelatin Hydrolysis test: negative DNA hydrolysis: Negative Lipid hydrolysis: Negative October 20th: Methyl Red and Voges-Proskauer: Negative Citrate test: Negative SIM medium test: Negative Nitrate reduction: Negative (first step and second step also negative). Urea Hydrolysis test: Negative Triple Iron Sugar test: Negative for fermentation Oct. 27th tests: Oxidase test: Negative MacConkey Agar test: Negative Eosin Methylene Blue agar test: Negative Hektoen Enteric Agar test: Negative Decarboxylation test: Negative Phenylalanine Deaminase Test: negative Nov 3rd: Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis. Manitol salt agar: Negative Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism. Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles. Salt tolerance test: Negative Bile Esculin test: Negative Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both. Nov 10th Antimicrobial susceptibility test (Kirby-Bauer method):

soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;  

Resistant to: Cefoxitin and Ceftazidime. Disinfectants: highly sensitive to 100% Bleach Somewhat sensitive to Lavender, 5% Bleach and Rosemary. Not sensitive to orange.

References

[Sample reference] Takai, K., Sugai, A., Itoh, T., and Horikoshi, K. "Palaeococcus ferrophilus gen. nov., sp. nov., a barophilic, hyperthermophilic archaeon from a deep-sea hydrothermal vent chimney". International Journal of Systematic and Evolutionary Microbiology. 2000. Volume 50. p. 489-500.

Author

Page authored by Tara English and Teresa Ramos, students of Prof. Kristine Hollingsworth at Austin Community College.