Soil Project- English/Ramos: Difference between revisions
m (→References) |
|||
(36 intermediate revisions by the same user not shown) | |||
Line 2: | Line 2: | ||
==Classification== | ==Classification== | ||
Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus | |||
===Species=== | ===Species=== | ||
Fictibacillus sp | |||
''Genus species'' | |||
Classification | |||
Bacillus Arsenicus also known as Fictibacillus arsenicus | |||
{| | {| | ||
Line 11: | Line 21: | ||
|} | |} | ||
Microbiology | |||
==Habitat Information == | ==Habitat Information == | ||
Describe the location and conditions under which the organism was isolated. | Describe the location and conditions under which the organism was isolated. | ||
Collection Date: September 7, 2017 | Collection Date: September 7, 2017 | ||
Air Temp: 76% | Air Temp: 76% | ||
Humidity: 36% | Humidity: 36% | ||
24Hr Rainfall: 0.00 | 24Hr Rainfall: 0.00 | ||
Pressure: 30.03” | Pressure: 30.03” | ||
Solar Radiation: 22.53 | Solar Radiation: 22.53 | ||
Depth of collection: surface to 1 inch deep | Depth of collection: surface to 1 inch deep | ||
Grid Coordinates: Lat 29.9425576 Long -98.4037259 | Grid Coordinates: Lat 29.9425576 Long -98.4037259 | ||
Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks. | Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks. | ||
==Description and Significance== | ==Description and Significance== | ||
Colony Morphology | |||
'''Colony Morphology''' | |||
Margin: Smooth | Margin: Smooth | ||
Elevation: convex | Elevation: convex | ||
Surface: smooth | Surface: smooth | ||
Color: very light | |||
Color: very light greenish tan | |||
Soluble Pigment: opaque | Soluble Pigment: opaque | ||
Cellular morphology: | |||
'''Cellular morphology:''' | |||
Gram positive rods in long chains. | Gram positive rods in long chains. | ||
Possible microbial activity: | |||
The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli. | |||
'''Significance''' | |||
Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes. | Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes. | ||
Arsenic resistant bacterium | Arsenic resistant bacterium | ||
Line 52: | Line 76: | ||
==Genome Structure== | ==Genome Structure== | ||
The soil microorganism was sent to a lab for sequencing and this was the result: | |||
AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC | AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC | ||
TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC | TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC | ||
Line 65: | Line 87: | ||
GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA | GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA | ||
Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result: | |||
Select seq KM598247.1 | |||
Fictibacillus sp. | |||
THG-SQK1 | |||
16S ribosomal RNA gene, | |||
partial sequence | |||
RID | |||
2NMY0NWT015 (Expires on 12-10 01:02 am) | |||
Query ID | |||
lcl|Query_140973 | |||
Description | |||
None | |||
Molecule type | |||
nucleic acid | |||
Query Length | |||
553 | |||
Database Name | |||
nr | |||
Description | |||
Nucleotide collection (nt) Program | |||
BLASTN 2.7.1+ | |||
==Cell Structure, Metabolism and Life Cycle== | ==Cell Structure, Metabolism and Life Cycle== | ||
From an internet research this is what we found on our soil microorganism: | |||
Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus. | |||
The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile. | |||
After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation. | |||
Gram positive cell structure: | |||
From results found in lab, organism was found to be gram positive. | |||
Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane. | |||
==Physiology and Pathogenesis== | ==Physiology and Pathogenesis== | ||
Biochemical characteristics | |||
Enzyme produced: casein | |||
Biochemical characteristics based on Chemical testing on the soil microorganism: | |||
October 6th tests: | October 6th tests: | ||
Phenol Red Broth: Negative for fermentation. | Phenol Red Broth: Negative for fermentation. | ||
Starch Hydrolysis test: Negative. | Starch Hydrolysis test: Negative. | ||
Casein Hydrolysis Test: Positive.[[File:Casein_Hydrolisis.png]] | |||
'''Casein Hydrolysis Test: Positive'''. | |||
[[File:Casein_Hydrolisis.png]] | |||
Gelatin Hydrolysis test: negative. | Gelatin Hydrolysis test: negative. | ||
DNA hydrolysis: Negative. | DNA hydrolysis: Negative. | ||
Lipid hydrolysis: Negative. | Lipid hydrolysis: Negative. | ||
October 20th: | October 20th: | ||
Methyl Red and Voges-Proskauer: Negative. | Methyl Red and Voges-Proskauer: Negative. | ||
Citrate test: Negative. | Citrate test: Negative. | ||
SIM medium test: Negative. | SIM medium test: Negative. | ||
Nitrate reduction: Negative (first step and second step also negative). | Nitrate reduction: Negative (first step and second step also negative). | ||
Urea Hydrolysis test: Negative. | Urea Hydrolysis test: Negative. | ||
Triple Iron Sugar test: Negative for fermentation. | Triple Iron Sugar test: Negative for fermentation. | ||
Oct. 27th tests: | Oct. 27th tests: | ||
Oxidase test: Negative. | Oxidase test: Negative. | ||
MacConkey Agar test: Negative. | MacConkey Agar test: Negative. | ||
Eosin Methylene Blue agar test: Negative. | Eosin Methylene Blue agar test: Negative. | ||
Hektoen Enteric Agar test: Negative. | Hektoen Enteric Agar test: Negative. | ||
Decarboxylation test: Negative. | Decarboxylation test: Negative. | ||
Phenylalanine Deaminase Test: negative. | Phenylalanine Deaminase Test: negative. | ||
Nov 3rd: | Nov 3rd: | ||
Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis. | |||
'''Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.''' | |||
Manitol salt agar: Negative. | Manitol salt agar: Negative. | ||
Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism. | |||
Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles. | '''Phenylethyl Alcohol Agar (PEA): Positive,''' the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism. | ||
'''Catalase test: Positive'''. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles. | |||
Salt tolerance test: Negative. | Salt tolerance test: Negative. | ||
Bile Esculin test: Negative. | Bile Esculin test: Negative. | ||
Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both. | Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both. | ||
Nov 10th | Nov 10th | ||
Antimicrobial susceptibility test (Kirby-Bauer method): | Antimicrobial susceptibility test (Kirby-Bauer method): | ||
soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam; | soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam; | ||
Resistant to: Cefoxitin and Ceftazidime. | Resistant to: Cefoxitin and Ceftazidime. | ||
Disinfectants: highly sensitive to 100% Bleach. | Disinfectants: highly sensitive to 100% Bleach. | ||
Somewhat sensitive to Lavender, 5% Bleach and Rosemary. | Somewhat sensitive to Lavender, 5% Bleach and Rosemary. | ||
Line 114: | Line 219: | ||
==References== | ==References== | ||
Genome sequence obtained from DNA BLAST web site https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch | |||
https://blast.ncbi.nlm.nih.gov/Blast.cgi | |||
Pictures taken in class. | Pictures taken in class. | ||
References | References | ||
Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus | Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus | ||
Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0 | Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0 |
Latest revision as of 19:40, 8 December 2017
Classification
Phylum: Firmicutes Genus: Bacillus Order: Bacillales Species: B. arsenicus
Species
Fictibacillus sp
Genus species
Classification
Bacillus Arsenicus also known as Fictibacillus arsenicus
NCBI: Taxonomy |
Microbiology
Habitat Information
Describe the location and conditions under which the organism was isolated.
Collection Date: September 7, 2017
Air Temp: 76%
Humidity: 36%
24Hr Rainfall: 0.00
Pressure: 30.03”
Solar Radiation: 22.53
Depth of collection: surface to 1 inch deep
Grid Coordinates: Lat 29.9425576 Long -98.4037259
Sample Location: In front of house right next to brick of house. Soil is noted to have large amounts of rocks.
Description and Significance
Colony Morphology
Margin: Smooth
Elevation: convex
Surface: smooth
Color: very light greenish tan
Soluble Pigment: opaque
Cellular morphology:
Gram positive rods in long chains.
Possible microbial activity: The soil microorganism had antibiotic activity when we performed the mixed culture on an LB culture plate with a lawn of E. coli; there was clearing around the soil microorganism demonstrating antibiotic activity against E. coli.
Significance
Has nematicidal capability against root-knot nematodes and free-living nematodes. Essentially is it is toxic to nematodes. Arsenic resistant bacterium
Genome Structure
The soil microorganism was sent to a lab for sequencing and this was the result: AGACCTGGTAAGGTTCTTCGCGTTGCTTCNAATTAAACCACATGCTCCACTGCTTGTGCGGGCCCCCGTCAATTCC TTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGTGTTAACTTCAGCACTGAGGGTGGAACCCCCC AACACCTAGNACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCACCCCACGCTTTCGCGCCTCAGC GTCAGTTACAGGCCAAAAAGCCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATT CCACTTTTCTCTCCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTT AGGAGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCNGATAACGCTTGCCACCTACGTATTACCGCGGCTGCTGGCAC GTAGTTAACCGTGGCTTTCTGGTTANGTACCGTCAAGGTACNAGCANTTACTCTCGTACTTGTTTCTTCTCTAACAA
Unable to obtain PCR from the the outside lab; instead we entered the sequence in the web site DNA BLAST and obtained this result:
Select seq KM598247.1 Fictibacillus sp. THG-SQK1 16S ribosomal RNA gene, partial sequence
RID
2NMY0NWT015 (Expires on 12-10 01:02 am)
Query ID
lcl|Query_140973
Description
None
Molecule type
nucleic acid
Query Length 553
Database Name
nr
Description
Nucleotide collection (nt) Program
BLASTN 2.7.1+
Cell Structure, Metabolism and Life Cycle
From an internet research this is what we found on our soil microorganism:
Scanning electron micrographs of the surface of a spheroidal concretion, a comparison of the lipid composition of B. arsenicus sp. nov. and B. barbaricus, and a neighbour-joining tree showing the phylogenetic relationships between B. arsenicus sp. nov. and other species of the genus Bacillus.
The soil microorganism did not show motility on the tests we performed, although in our research the microorganism is described as motile. After one week of being cultured on an LB plate, we did not see endospore formation; this occurred probably because it was too soon to see endospore formation. On our research there is evidence of endospore formation.
Gram positive cell structure:
From results found in lab, organism was found to be gram positive. Gram positive cell structures have multiple layers of peptidoglycan that covers the cell membrane.
Physiology and Pathogenesis
Enzyme produced: casein
Biochemical characteristics based on Chemical testing on the soil microorganism:
October 6th tests:
Phenol Red Broth: Negative for fermentation.
Starch Hydrolysis test: Negative.
Casein Hydrolysis Test: Positive.
Gelatin Hydrolysis test: negative.
DNA hydrolysis: Negative.
Lipid hydrolysis: Negative.
October 20th:
Methyl Red and Voges-Proskauer: Negative.
Citrate test: Negative.
SIM medium test: Negative.
Nitrate reduction: Negative (first step and second step also negative).
Urea Hydrolysis test: Negative.
Triple Iron Sugar test: Negative for fermentation.
Oct. 27th tests:
Oxidase test: Negative.
MacConkey Agar test: Negative.
Eosin Methylene Blue agar test: Negative.
Hektoen Enteric Agar test: Negative.
Decarboxylation test: Negative.
Phenylalanine Deaminase Test: negative.
Nov 3rd:
Blood agar: soil microorganism had a weak alpha positive result; this means it causes partial hemolysis.
Manitol salt agar: Negative.
Phenylethyl Alcohol Agar (PEA): Positive, the soil microorganism had growth. This means it is not gram negative because this media inhibits growth of gram negative microorganisms. This media is selective for gram positive microorganisms; it actually promotes the growth of gram positive. This confirms it is a gram positive organism.
Catalase test: Positive. When drops of hydrogen peroxide were placed on a colony that had been spread on a slide, it produced bubbles.
Salt tolerance test: Negative.
Bile Esculin test: Negative.
Bacitracin/Optochin Susceptibility test: Soil microorganism was resistant to both.
Nov 10th
Antimicrobial susceptibility test (Kirby-Bauer method):
soil microorganism was sensitive to Ticarcinin/Clavulanic acid, Vancomycin and Ampicilli/Sulbactam;
Resistant to: Cefoxitin and Ceftazidime.
Disinfectants: highly sensitive to 100% Bleach. Somewhat sensitive to Lavender, 5% Bleach and Rosemary. Not sensitive to orange.
References
Genome sequence obtained from DNA BLAST web site https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch https://blast.ncbi.nlm.nih.gov/Blast.cgi
Pictures taken in class.
References
Bacillus arsenicus. (2017, August 13). Retrieved December 07, 2017, from https://en.wikipedia.org/wiki/Bacillus_arsenicus Shivaji, S., Suresh, K., Chaturvedi, P., Dube, S., & Sengupta, S. (2005, May 01). Bacillus arsenicus sp. nov., an arsenic-resistant bacterium isolated from a siderite concretion in West Bengal, India. Retrieved December 07, 2017, from http://ijs.microbiologyresearch.org/content/journal/ijsem/10.1099/ijs.0.63476-0
Author
Page authored by Tara English and Teresa Ramos, students of Prof. Kristine Hollingsworth at Austin Community College.